Skip to content

Latest commit

 

History

History
241 lines (186 loc) · 9.97 KB

File metadata and controls

241 lines (186 loc) · 9.97 KB

crypt4gh-tutorial

The first part of the tutorial is on how to use the C implementation of crypt4gh to encrypt and read encrypted files using samtools. Most information was shared with by Robert Davies.

The second part of the tutorial will handle crypt4gh on FUSE mounts. This will allow for encryption and reading / manipulating of encrypted files by any tools on the system.

The last part is how to use the container to also achieve what was performed in the first and second part.

Test samtools on C implementation of crypt4gh

Get source code

mkdir $HOME/opt; cd $HOME/opt
git clone https://github.com/samtools/htslib.git
git clone https://github.com/samtools/samtools.git
git clone https://github.com/samtools/htslib-crypt4gh.git

Install htslib

cd htslib; git submodule update --init --recursive; autoreconf -i; ./configure --prefix=$HOME/opt/samtools --enable-plugins --enable-libcurl; make && make install

Install samtools

cd ../samtools; autoreconf -i; ./configure --prefix=$HOME/opt/samtools --with-htslib=$HOME/opt/samtools LDFLAGS="-Wl,-R$HOME/opt/samtools/lib"; make && make install

Install htslib-crypt4g

cd ../htslib-crypt4gh; autoreconf -i; ./configure --prefix=$HOME/opt/samtools; make && make install

To generate some keys, you can use:

$HOME/opt/samtools/bin/crypt4gh-agent -g my_key

It will ask you for a passphrase twice, then generate the keys. You should end up in a new shell, with a CRYPT4GH_AGENT environment variable set in it. This is used by HTSlib to talk to the agent.

If you already have the keys, you can start it with:

$HOME/opt/samtools/bin/crypt4gh-agent -k my_key.pub -k my_key.sec

You only actually need both keys if you want to read and write files reading needs my_key.sec and writing my_key.pub. If you only want to do one of these, you can leave out the other key for slightly improved security. An example of where this might be useful is where you want to encrypt the data produced by your sequencing machine. The process doing this only needs the public key, which means you can keep the secret part locked away somewhere secure. Anyone compromising the process would be able to see the data being worked on at the time, but would not be able to read any of the other files that you've made. It also means you don't have to enter a passphrase, as they're only needed for secret keys.

Once you're in the shell started by the agent, you can read and write encrypted files using samtools, for example:

Grab a file:

curl 'ftp://ftp.sra.ebi.ac.uk/vol1/run/ERR531/ERR5313536/MILK-11786A3.210210_A01250_0009_AH32GCDRXY.2t282.cram' > /tmp/MILK-11786A3.cram

Convert to BAM and encrypt:

$HOME/opt/samtools/bin/samtools view -b -o crypt4gh:/tmp/secret.bam /tmp/MILK-11786A3.cram

You can use the htsfile utility to find out what you made:

$HOME/opt/samtools/bin/htsfile /tmp/secret.bam
/tmp/secret.bam:  crypt4gh data
$HOME/opt/samtools/bin/htsfile crypt4gh:/tmp/secret.bam
crypt4gh:/tmp/secret.bam: BAM version 1 compressed sequence data

You can work on it with samtools:

$HOME/opt/samtools/bin/samtools view -H /tmp/secret.bam
@HD	VN:1.6	SO:coordinate
@SQ	SN:MN908947.3	LN:29903	UR:https://www.ncbi.nlm.nih.gov/nuccore/MN908947.3?report=fasta	AS:MN908947.3	M5:105c82802b67521950854a851fc6eefd	SP:SARS-CoV-2 isolate Wuhan-Hu-1
@PG	PN:bwa	ID:bwa	VN:0.7.17-r1188	CL:bwa mem -t 4 MN908947.3.fa 36316_2#316_1_val_1.fq.gz 36316_2#316_2_val_2.fq.gz
@PG	PN:dehumanizer	ID:dehumanizer.20210215	VN:0.8.1	CL:/lustre/scratch121/esa-analysis-20200609/tmp/kl2/miniconda3/bin/dehumanise /lustre/scratch121/esa-analysis-20200609/tmp/kl2/ftc/manifest.txt /dev/stdin --preset sr --bam -o /dev/stdout --trash-minalen 25 --log dhlog.log	PP:bwa
@PG	ID:samtools	PN:samtools	PP:dehumanizer.20210215	VN:1.11	CL:/software/pkgg/samtools/1.11.0/bin/samtools view -h -
@PG	ID:samtools.1	PN:samtools	PP:samtools	VN:1.11	CL:/software/pkgg/samtools/1.11.0/bin/samtools view -b -
@PG	ID:samtools.2	PN:samtools	PP:samtools.1	VN:1.11	CL:/software/pkgg/samtools/1.11.0/bin/samtools view -C -
@PG	ID:samtools.3	PN:samtools	PP:samtools.2	VN:1.12-5-ge2d9a70	CL:/home/gerrit/opt/samtools/bin/samtools view -b -o crypt4gh:/tmp/secret.bam /tmp/MILK-10285F1.cram
@PG	ID:samtools.4	PN:samtools	PP:samtools.3	VN:1.12-5-ge2d9a70	CL:/home/gerrit/opt/samtools/bin/samtools view -H /tmp/secret.bam

When reading files, recent versions of HTSlib (1.11+) should be able to detect crypt4gh files on reading and automatically pass them to the plugin to decrypt. Older versions will need a bit of help, so you have to include the 'crypt4gh:' prefix.

When you've finished work, typing exit in the shell will quit it and close down the agent process.

One other trick you can do with the agent is to give it a command to run, for example:

$HOME/opt/samtools/bin/crypt4gh-agent -k my_key.pub -- $HOME/opt/samtools/bin/samtools view -b -o crypt4gh:/tmp/secret.bam /tmp/MILK-11786A3.cram

should start the agent, run samtools in it to encrypt the file and then shut everything down again. You won't have to type a passphrase in this case as you didn't give it a secret key. In theory you can run entire pipelines like this, as long as they don't try to run any remote processes.

Also can add --verbosity=8 to the samtools command to get more details on the plugin added.

Test samtools on crypt4ghfs

I followed the steps here: https://github.com/EGA-archive/crypt4ghfs with slight modifications.

Install necessary packages

sudo apt-get install ca-certificates pkg-config git gcc make automake autoconf libtool bzip2 zlib1g-dev libssl-dev libedit-dev ninja-build cmake udev libc6-dev

I have a Python 3.7 conda environment already set up

conda activate py3.7
conda install meson pytest

Install libfuse

git clone https://github.com/libfuse/libfuse.git
cd libfuse
git checkout fuse-3.10.0
mkdir build
cd build
meson ..
ninja
ninja install

Install sshfs

git clone https://github.com/libfuse/sshfs.git
cd sshfs
git checkout sshfs-3.7.0
mkdir build
cd build
meson ..
ninja
ninja install

Setup library path

export LD_LIBRARY_PATH=/usr/local/lib/x86_64-linux-gnu/

Install cryptfhfs

pip install crypt4ghfs

Also install crypt4gh to encrypt a test file.

pip install crypt4gh

Check my keys and config

ls $HOME/crypt4gh-tutorial
crypt4ghfs.conf  my_key.pub  my_key.sec

Enabled user_allow_other in /usr/local/etc/fuse.conf

Set permissions on configuration file (example of config file is here)

chmod 600 $HOME/crypt4gh-tutorial/crypt4ghfs.conf

Now lets encrypt a CRAM file

First get the CRAM file

curl 'ftp://ftp.sra.ebi.ac.uk/vol1/run/ERR531/ERR5313536/MILK-11786A3.210210_A01250_0009_AH32GCDRXY.2t282.cram' > tmp/MILK-11786A3.cram

And encrypt using crypt4gh (could have used the file encrypted with htslib-crypt4gh here as well)

crypt4gh encrypt --sk $HOME/crypt4gh-tutorial/my_key.sec --recipient_pk $HOME/crypt4gh-tutorial/my_key.pub < tmp/MILK-11786A3.cram > encrypted-files/MILK-11786A3.c4gh

Now lets mount crypt4ghfs

crypt4ghfs --conf $HOME/crypt4gh-tutorial/crypt4ghfs.conf $HOME/crypt4gh-tutorial/clear-files/

Lets view with samtools

$HOME/opt/samtools/bin/samtools view clear-files/MILK-11786A3 | head -n2
A01250:9:H32GCDRXY:2:2250:1145:29121	2145	MN908947.3	18	60	94H58M69H	=	28263	28447	TCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAAC	FFFFFFFFFFFF:FFFFFFFFFFFF:F:F:F:FFFFFFFFF:FFFFF:FFFFFFFFFF	MC:Z:8M1D193M	AS:i:58	XS:i:0	SA:Z:MN908947.3,27447,+,94M127S,60,0;MN908947.3,28255,+,141S16M1D64M,60,4;	MD:Z:58	NM:i:0
A01250:9:H32GCDRXY:2:2152:1723:4445	2145	MN908947.3	18	60	94H58M69H	=	28263	28447	TCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAAC	FFFFFFFFFFFF:FFFFFFFFFF:FFFFFFFF:FFF::FFFFFFFFFFFF:FFFFF,F	MC:Z:8M1D193M	AS:i:58	XS:i:0	SA:Z:MN908947.3,27447,+,94M127S,60,0;MN908947.3,28255,+,141S16M1D64M,60,4;	MD:Z:58	NM:i:0

Using the container

To pull the image do:

docker pull quay.io/grbot/crypt4gh-tutorial`

docker image tag quay.io/grbot/crypt4gh-tutorial crypt4gh-tutorial

Create your keypair. This will send you into the container and ask for the passphrase. You need to exit again to get to your local machine. Your key pair would be in pwd

docker run -it -v `pwd`:/home/ubuntu crypt4gh-tutorial crypt4gh-agent -g my_key

Pull a sample. Do this on your local machine.

curl 'ftp://ftp.sra.ebi.ac.uk/vol1/run/ERR531/ERR5313536/MILK-11786A3.210210_A01250_0009_AH32GCDRXY.2t282.cram' > /tmp/MILK-11786A3.cram

Encrypt with crypt4gh

docker run -it -v /tmp:/tmp -v `pwd`:/home/ubuntu crypt4gh-tutorial /bin/bash -c "crypt4gh encrypt --sk my_key.sec --recipient_pk my_key.pub < /tmp/MILK-11786A3.cram > /tmp/secret2.c4gh"

Mount and access

docker run --user root --privileged -it -v /usr/local/etc/fuse.conf:/usr/local/etc/fuse.conf  -v /tmp:/home/ubuntu/encrypted-files -v `pwd`:/home/ubuntu crypt4gh-tutorial /bin/bash

Now in container

crypt4ghfs --conf crypt4ghfs.conf clear-files
samtools view clear-files/secret2 | head -n 2

Produce

A01250:9:H32GCDRXY:2:2250:1145:29121    2145    MN908947.3    18    60    94H58M69H    =    28263    28447    TCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAAC    FFFFFFFFFFFF:FFFFFFFFFFFF:F:F:F:FFFFFFFFF:FFFFF:FFFFFFFFFF    MC:Z:8M1D193M    AS:i:58XS:i:0    SA:Z:MN908947.3,27447,+,94M127S,60,0;MN908947.3,28255,+,141S16M1D64M,60,4;    MD:Z:58    NM:i:0
A01250:9:H32GCDRXY:2:2152:1723:4445    2145    MN908947.3    18    60    94H58M69H    =    28263    28447    TCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAAC    FFFFFFFFFFFF:FFFFFFFFFF:FFFFFFFF:FFF::FFFFFFFFFFFF:FFFFF,F    MC:Z:8M1D193M    AS:i:58XS:i:0    SA:Z:MN908947.3,27447,+,94M127S,60,0;MN908947.3,28255,+,141S16M1D64M,60,4;    MD:Z:58    NM:i:0

Other

With the Python implementation of crypt4gh multiple public keys can be added which allows for different users to decrypt if they have the corresponding private key. See usage here.