From 6f44f7a5eba2ffb099bfcdd741c2e3dd8592c33f Mon Sep 17 00:00:00 2001 From: Hernan Morales Date: Sat, 4 Apr 2026 12:05:36 -0300 Subject: [PATCH] Add basic restriction enzymes support --- repository/BioFormatters/BioACEFile.class.st | 10 +- .../BioFormatters/BioAlignment.extension.st | 6 +- .../BioBEDDetailFormatter.class.st | 10 +- .../BioFormatters/BioBEDFormatter.class.st | 84 ++-- .../BioBEDGraphFormatter.class.st | 10 +- .../BioFormatters/BioBigBEDFormatter.class.st | 18 +- .../BioBlastCSVFormatter.class.st | 36 +- repository/BioFormatters/BioCSVFile.class.st | 32 +- .../BioCSVFileCollection.class.st | 10 +- .../BioFormatters/BioCSVFormatter.class.st | 26 +- .../BioContractionNaming.class.st | 26 +- .../BioEIGENSTRATWriter.class.st | 78 ++-- .../BioFormatters/BioFASTAFile.class.st | 12 +- .../BioFASTAFileCollection.class.st | 10 +- .../BioFormatters/BioFASTAFormatter.class.st | 38 +- repository/BioFormatters/BioFile.class.st | 30 +- .../BioFormatters/BioFileFormat.class.st | 54 +-- .../BioFormatters/BioFileFormatter.class.st | 70 +-- .../BioFlatGenBankFormatter.class.st | 16 +- .../BioFluxusRDFFormatter.class.st | 30 +- .../BioFormatters/BioFormatter.class.st | 50 +-- .../BioGBSeqCSVFormatter.class.st | 40 +- .../BioFormatters/BioGFF3Formatter.class.st | 14 +- .../BioFormatters/BioGenBankFile.class.st | 10 +- .../BioGoogleFusionTablesFormatter.class.st | 16 +- .../BioHaploViewFormatter.class.st | 46 +- .../BioFormatters/BioMAPFormatter.class.st | 28 +- .../BioFormatters/BioMEGAFormatter.class.st | 138 +++--- .../BioFormatters/BioMEGASeqRecord.class.st | 20 +- .../BioFormatters/BioMatrixFormatter.class.st | 54 +-- repository/BioFormatters/BioNaming.class.st | 12 +- .../BioFormatters/BioNewickFormatter.class.st | 8 +- .../BioFormatters/BioNexusBlock.class.st | 8 +- .../BioFormatters/BioPEDFormatter.class.st | 14 +- .../BioPHASECSVFormatter.class.st | 22 +- .../BioFormatters/BioPhaseINPFile.class.st | 20 +- .../BioFormatters/BioPhaseMAPFile.class.st | 10 +- repository/BioFormatters/BioPhylip.class.st | 26 +- .../BioFormatters/BioPhylipFile.class.st | 18 +- .../BioRDFLegacyFormatter.class.st | 48 ++- .../BioRehhLogPValueCollector.class.st | 52 +-- .../BioRestrictionMapFormatter.class.st | 54 +++ .../BioSequenceFeature.extension.st | 6 +- .../BioSequenceFeatureFormatter.class.st | 14 +- .../BioSequenceFormatter.class.st | 18 +- .../BioFormatters/BioStandardNaming.class.st | 10 +- .../BioFormatters/BioVCFFormatter.class.st | 66 +-- .../BioFormatters/BioVCFRecord.class.st | 106 ++--- .../BioFormatters/BioVCFRecordSample.class.st | 36 +- .../BioFormatters/BioVCFRecordWriter.class.st | 74 ++-- .../BioFormatters/BioXMLFormatter.class.st | 14 +- .../BioFormatters/Dictionary.extension.st | 4 +- repository/BioFormatters/Object.extension.st | 4 +- .../BioFormatters/PMVector.extension.st | 14 +- repository/BioFormatters/package.st | 2 +- .../BioParsers/BioAbstractALParser.class.st | 10 +- .../BioParsers/BioAbstractParser.class.st | 64 +-- .../BioParsers/BioAbstractTextParser.class.st | 22 +- .../BioParsers/BioAccessionParser.class.st | 22 +- .../BioAmbiguousBaseParser.class.st | 34 +- .../BioParsers/BioBlastContainerNode.class.st | 32 +- .../BioParsers/BioBlastHitNode.class.st | 18 +- .../BioParsers/BioBlastHspNode.class.st | 18 +- repository/BioParsers/BioBlastNode.class.st | 50 +-- .../BioParsers/BioBlastParentNode.class.st | 186 ++++---- .../BioParsers/BioBlastRootNode.class.st | 14 +- .../BioParsers/BioBlastStructureNode.class.st | 16 +- .../BioParsers/BioBlastValueNode.class.st | 20 +- .../BioBrookhavenProtParser.class.st | 16 +- .../BioParsers/BioCompositeIDParser.class.st | 14 +- repository/BioParsers/BioDDBJParser.class.st | 10 +- repository/BioParsers/BioEMBLParser.class.st | 12 +- .../BioParsers/BioEResultKeysParser.class.st | 16 +- .../BioParsers/BioEntrezResultParser.class.st | 18 +- .../BioEntrezXMLGBBasicParser.class.st | 14 +- .../BioEntrezXMLGBFullParser.class.st | 14 +- ...ioEntrezXMLGBSeqFeatureQualParser.class.st | 12 +- .../BioEntrezXMLGBSeqFullParser.class.st | 12 +- .../BioEntrezXMLGBSeqJournalParser.class.st | 14 +- .../BioEntrezXMLGBSeqParser.class.st | 24 +- .../BioEntrezXMLGenBankSeqParser.class.st | 24 +- .../BioEntrezXMLGenSetParser.class.st | 20 +- .../BioParsers/BioFASTABasicParser.class.st | 34 +- .../BioParsers/BioFASTAMultiParser.class.st | 12 +- repository/BioParsers/BioFASTAParser.class.st | 26 +- .../BioParsers/BioFastaRecord.extension.st | 4 +- .../BioParsers/BioFlatGenBankParser.class.st | 8 +- repository/BioParsers/BioGBParser.class.st | 12 +- .../BioParsers/BioGIBackBoneIdParser.class.st | 10 +- repository/BioParsers/BioGIParser.class.st | 14 +- .../BioParsers/BioGenBankAssociation.class.st | 10 +- .../BioParsers/BioGenBankRecord.class.st | 8 +- repository/BioParsers/BioIDParser.class.st | 16 +- repository/BioParsers/BioLocalParser.class.st | 10 +- repository/BioParsers/BioMAFParser.class.st | 14 +- .../BioParsers/BioNCBIBlastSAXParser.class.st | 20 +- .../BioNCBIBlastSAXTokenizer.class.st | 14 +- .../BioNCBIGenericIdParser.class.st | 14 +- .../BioParsers/BioNCBIIdParser.class.st | 20 +- .../BioParsers/BioNCBILocusParser.class.st | 16 +- .../BioParsers/BioNCBIXMLBlastParser.class.st | 16 +- repository/BioParsers/BioParser.class.st | 94 +++-- .../BioParsers/BioPatentsParser.class.st | 14 +- .../BioParsers/BioPhylipParser.class.st | 44 +- .../BioParsers/BioProtInfoParser.class.st | 14 +- .../BioParsers/BioProtResParser.class.st | 14 +- .../BioParsers/BioQBlastParser.class.st | 16 +- .../BioParsers/BioREBASEParser.class.st | 31 ++ .../BioParsers/BioRefSeqParser.class.st | 12 +- repository/BioParsers/BioSAXParser.class.st | 56 +-- .../BioParsers/BioSwissProtParser.class.st | 18 +- .../BioParsers/BioXMLDictionary.class.st | 12 +- .../BioParsers/BioXMLDictionaryMap.class.st | 12 +- .../BioXMLOrderedCollection.class.st | 10 +- repository/BioParsers/BioXMLParser.class.st | 42 +- .../BioParsers/BioXMLResultFormatter.class.st | 10 +- repository/BioParsers/Collection.extension.st | 4 +- repository/BioParsers/Dictionary.extension.st | 4 +- repository/BioParsers/Number.extension.st | 8 +- .../BioParsers/OrderedCollection.extension.st | 4 +- .../BioParsers/PP2ActionNode.extension.st | 4 +- .../BioParsers/PP2NodeFactory.extension.st | 18 +- .../SequenceableCollection.extension.st | 4 +- repository/BioParsers/String.extension.st | 12 +- repository/BioParsers/package.st | 2 +- .../BioFastaMultiRecordTest.class.st | 28 +- .../BioTools-Tests/BioLocusTest.class.st | 5 +- .../BioTools-Tests/BioMutableSeqTest.class.st | 5 + .../BioTools-Tests/BioPositionTest.class.st | 36 +- .../BioRestrictionTest.class.st | 248 +++++++++++ .../BioTools-Tests/BioSequenceTest.class.st | 68 ++- repository/BioTools/BioCatalysis.class.st | 50 +++ .../BioTools/BioCircularSequence.class.st | 163 +++++++ repository/BioTools/BioEnzyme.class.st | 74 ++++ repository/BioTools/BioProtein.class.st | 16 + repository/BioTools/BioReaction.class.st | 88 ++++ .../BioTools/BioRestrictionEnzyme.class.st | 178 ++++++++ repository/BioTools/BioSeqRecord.class.st | 9 + repository/BioTools/BioSequence.class.st | 398 +++++++++++------- 139 files changed, 2872 insertions(+), 1639 deletions(-) create mode 100644 repository/BioFormatters/BioRestrictionMapFormatter.class.st create mode 100644 repository/BioParsers/BioREBASEParser.class.st create mode 100644 repository/BioTools-Tests/BioRestrictionTest.class.st create mode 100644 repository/BioTools/BioCatalysis.class.st create mode 100644 repository/BioTools/BioCircularSequence.class.st create mode 100644 repository/BioTools/BioEnzyme.class.st create mode 100644 repository/BioTools/BioProtein.class.st create mode 100644 repository/BioTools/BioReaction.class.st create mode 100644 repository/BioTools/BioRestrictionEnzyme.class.st diff --git a/repository/BioFormatters/BioACEFile.class.st b/repository/BioFormatters/BioACEFile.class.st index 2b622bdf..c52c742d 100644 --- a/repository/BioFormatters/BioACEFile.class.st +++ b/repository/BioFormatters/BioACEFile.class.st @@ -1,10 +1,12 @@ Class { - #name : #BioACEFile, - #superclass : #BioFile, - #category : 'BioFormatters-Files' + #name : 'BioACEFile', + #superclass : 'BioFile', + #category : 'BioFormatters-Files', + #package : 'BioFormatters', + #tag : 'Files' } -{ #category : #examples } +{ #category : 'examples' } BioACEFile class >> example01 [ | fh aceRecord | diff --git a/repository/BioFormatters/BioAlignment.extension.st b/repository/BioFormatters/BioAlignment.extension.st index 6bbc2343..9923d336 100644 --- a/repository/BioFormatters/BioAlignment.extension.st +++ b/repository/BioFormatters/BioAlignment.extension.st @@ -1,6 +1,6 @@ -Extension { #name : #BioAlignment } +Extension { #name : 'BioAlignment' } -{ #category : #'*BioFormatters' } +{ #category : '*BioFormatters' } BioAlignment >> asPhylip [ " Answer a instance with receiver's contents properly filled " @@ -11,7 +11,7 @@ BioAlignment >> asPhylip [ yourself ] -{ #category : #'*BioFormatters' } +{ #category : '*BioFormatters' } BioAlignment >> asPhylipString [ " Answer the receiver as a Phylip record object " diff --git a/repository/BioFormatters/BioBEDDetailFormatter.class.st b/repository/BioFormatters/BioBEDDetailFormatter.class.st index d226971c..30dd6e26 100644 --- a/repository/BioFormatters/BioBEDDetailFormatter.class.st +++ b/repository/BioFormatters/BioBEDDetailFormatter.class.st @@ -3,12 +3,14 @@ Extension of the BED format which enhances track details supporting links and lo " Class { - #name : #BioBEDDetailFormatter, - #superclass : #BioBEDFormatter, - #category : 'BioFormatters-Formatters-BED' + #name : 'BioBEDDetailFormatter', + #superclass : 'BioBEDFormatter', + #category : 'BioFormatters-Formatters-BED', + #package : 'BioFormatters', + #tag : 'Formatters-BED' } -{ #category : #accessing } +{ #category : 'accessing' } BioBEDDetailFormatter >> fileNamePrefix [ " Answer a default prefix for the output file name " diff --git a/repository/BioFormatters/BioBEDFormatter.class.st b/repository/BioFormatters/BioBEDFormatter.class.st index d9f40cbb..bc1bb4d2 100644 --- a/repository/BioFormatters/BioBEDFormatter.class.st +++ b/repository/BioFormatters/BioBEDFormatter.class.st @@ -10,24 +10,26 @@ BioBEDFormatter new " Class { - #name : #BioBEDFormatter, - #superclass : #BioSequenceFeatureFormatter, + #name : 'BioBEDFormatter', + #superclass : 'BioSequenceFeatureFormatter', #instVars : [ 'properties', 'browser', 'orderIndex' ], - #category : #'BioFormatters-Formatters-BED' + #category : 'BioFormatters-Formatters-BED', + #package : 'BioFormatters', + #tag : 'Formatters-BED' } -{ #category : #accessing } +{ #category : 'accessing' } BioBEDFormatter class >> description [ " See superimplementor's comment " ^ 'Browser Extensible Data (BED) format' ] -{ #category : #examples } +{ #category : 'examples' } BioBEDFormatter class >> example01 [ " Example writing one track " @@ -52,7 +54,7 @@ BioBEDFormatter class >> example01 [ ] -{ #category : #examples } +{ #category : 'examples' } BioBEDFormatter class >> example02 [ " Example writing multiple tracks " @@ -100,21 +102,21 @@ BioBEDFormatter class >> example02 [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioBEDFormatter class >> formatExtension [ "Answer a corresponding for the receiver's file output format" ^ 'bed' ] -{ #category : #testing } +{ #category : 'testing' } BioBEDFormatter class >> testFilesFullDirectoryName [ " Private - See superimplementor's comment " ^ super testFilesFullDirectoryName / self formatExtension ] -{ #category : #'accessing - adding features' } +{ #category : 'accessing - adding features' } BioBEDFormatter >> addCFBlockCount: aNumber [ " Add the number of blocks (exons) in the BED line. " @@ -126,7 +128,7 @@ BioBEDFormatter >> addCFBlockCount: aNumber [ ] -{ #category : #'accessing - adding features' } +{ #category : 'accessing - adding features' } BioBEDFormatter >> addCFBlockSizes: aCollection [ " Add block sizes in aCollection. The number of items in this list should correspond to blockCount. " @@ -140,7 +142,7 @@ BioBEDFormatter >> addCFBlockSizes: aCollection [ ] -{ #category : #'accessing - adding features' } +{ #category : 'accessing - adding features' } BioBEDFormatter >> addCFBlockStarts: aCollection [ " Add block sizes in aCollection. All of the blockStart positions should be calculated relative to chromStart. The number of items in this list should correspond to blockCount. " @@ -154,7 +156,7 @@ BioBEDFormatter >> addCFBlockStarts: aCollection [ ] -{ #category : #'accessing - adding features' } +{ #category : 'accessing - adding features' } BioBEDFormatter >> addCFChr: chrString start: chrStart end: chrEnd [ " Write minimal Custom Feature data in BED format. @@ -172,7 +174,7 @@ BioBEDFormatter >> addCFChr: chrString start: chrStart end: chrEnd [ self orderIndex: 4. ] -{ #category : #'accessing - adding features' } +{ #category : 'accessing - adding features' } BioBEDFormatter >> addCFLineChr: chrString start: chrStart end: chrEnd [ " Write minimal Custom Feature data line in BED format. @@ -186,7 +188,7 @@ BioBEDFormatter >> addCFLineChr: chrString start: chrStart end: chrEnd [ nextPutTerminator ] -{ #category : #'accessing - adding features' } +{ #category : 'accessing - adding features' } BioBEDFormatter >> addCFName: aString [ " Add current feature name for the current data line " @@ -198,7 +200,7 @@ BioBEDFormatter >> addCFName: aString [ ] -{ #category : #'accessing - adding features' } +{ #category : 'accessing - adding features' } BioBEDFormatter >> addCFRGB: colorCollection [ " Add current feature individual color for the current data line. colorCollection is a of instances in RGB order " @@ -215,7 +217,7 @@ BioBEDFormatter >> addCFRGB: colorCollection [ ] -{ #category : #'accessing - adding features' } +{ #category : 'accessing - adding features' } BioBEDFormatter >> addCFScore: aNumber [ " Add a description for custom tracks. aNumber must be between 0 and 1000 " @@ -227,7 +229,7 @@ BioBEDFormatter >> addCFScore: aNumber [ self orderIndex: self orderIndex + 1. ] -{ #category : #'accessing - adding features' } +{ #category : 'accessing - adding features' } BioBEDFormatter >> addCFStrand: aCharacter [ self assert: [ self orderIndex = 6 ]. @@ -238,7 +240,7 @@ BioBEDFormatter >> addCFStrand: aCharacter [ self orderIndex: self orderIndex + 1. ] -{ #category : #'accessing - adding features' } +{ #category : 'accessing - adding features' } BioBEDFormatter >> addCFThickEnd: aNumber [ self assert: [ self orderIndex = 8 ]. @@ -248,7 +250,7 @@ BioBEDFormatter >> addCFThickEnd: aNumber [ self orderIndex: self orderIndex + 1. ] -{ #category : #'accessing - adding features' } +{ #category : 'accessing - adding features' } BioBEDFormatter >> addCFThickStart: aNumber [ self assert: [ self orderIndex = 7 ]. @@ -258,7 +260,7 @@ BioBEDFormatter >> addCFThickStart: aNumber [ self orderIndex: self orderIndex + 1. ] -{ #category : #'accessing - custom track header' } +{ #category : 'accessing - custom track header' } BioBEDFormatter >> addCTrackColor: colorCollection [ " Sets the default visibility mode for this track. colorCollection must have 3 instances " @@ -271,7 +273,7 @@ BioBEDFormatter >> addCTrackColor: colorCollection [ put: rgbColors ] -{ #category : #'accessing - custom track header' } +{ #category : 'accessing - custom track header' } BioBEDFormatter >> addCTrackColorByStrand: colorCollection [ " Sets the default visibility mode for this track. colorCollection must have 6 RGB instances " @@ -285,7 +287,7 @@ BioBEDFormatter >> addCTrackColorByStrand: colorCollection [ put: ((plusStrand , ' ' , minorStrand) surroundedBy: '"') ] -{ #category : #'accessing - custom track header' } +{ #category : 'accessing - custom track header' } BioBEDFormatter >> addCTrackDescription: aString [ " Add a description for custom tracks " @@ -294,7 +296,7 @@ BioBEDFormatter >> addCTrackDescription: aString [ put: (aString surroundedBy: '"') ] -{ #category : #'accessing - custom track header' } +{ #category : 'accessing - custom track header' } BioBEDFormatter >> addCTrackName: aString [ " Add description name (for custom track displayed in the Genome Browser)" @@ -303,7 +305,7 @@ BioBEDFormatter >> addCTrackName: aString [ put: (aString surroundedBy: '"') ] -{ #category : #'accessing - custom track header' } +{ #category : 'accessing - custom track header' } BioBEDFormatter >> addCTrackUseScore: aNumber [ self properties @@ -311,7 +313,7 @@ BioBEDFormatter >> addCTrackUseScore: aNumber [ put: aNumber asString ] -{ #category : #'accessing - custom track header' } +{ #category : 'accessing - custom track header' } BioBEDFormatter >> addCTrackVisibility: aNumber [ " Sets the default visibility mode for this track. " @@ -320,7 +322,7 @@ BioBEDFormatter >> addCTrackVisibility: aNumber [ put: aNumber asString ] -{ #category : #accessing } +{ #category : 'accessing' } BioBEDFormatter >> asStringFromFeature: aBioSequenceFeature [ ^ String streamContents: [ : writeStream | @@ -332,26 +334,26 @@ BioBEDFormatter >> asStringFromFeature: aBioSequenceFeature [ nextPutAll: aBioSequenceFeature end asString ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioBEDFormatter >> browser [ ^ browser ifNil: [ browser := BioPropertyObject new ] ] -{ #category : #'accessing - custom track browser' } +{ #category : 'accessing - custom track browser' } BioBEDFormatter >> browser: aBioPropertyObject [ browser := aBioPropertyObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioBEDFormatter >> delimiter [ " Answer the Character used to delimit fields in data lines " ^ Character space ] -{ #category : #private } +{ #category : 'private' } BioBEDFormatter >> dumpBrowserHeader [ " Private - Write custom track browser line " @@ -367,7 +369,7 @@ BioBEDFormatter >> dumpBrowserHeader [ self outputFileStream nextPutTerminator ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioBEDFormatter >> dumpCTrack [ " Private - Write custom track header line " @@ -382,7 +384,7 @@ BioBEDFormatter >> dumpCTrack [ flush ] -{ #category : #accessing } +{ #category : 'accessing' } BioBEDFormatter >> dumpHeaders [ self @@ -390,31 +392,31 @@ BioBEDFormatter >> dumpHeaders [ dumpCTrack ] -{ #category : #accessing } +{ #category : 'accessing' } BioBEDFormatter >> fileNamePrefix [ " Answer a default prefix for the output file name " ^ 'BioST-Export-BED_' ] -{ #category : #accessing } +{ #category : 'accessing' } BioBEDFormatter >> nextPutTerminator [ " Set the end of a data line " self outputFileStream nextPutTerminator ] -{ #category : #accessing } +{ #category : 'accessing' } BioBEDFormatter >> orderIndex [ ^ orderIndex ] -{ #category : #accessing } +{ #category : 'accessing' } BioBEDFormatter >> orderIndex: anObject [ orderIndex := anObject ] -{ #category : #'accessing - custom track header' } +{ #category : 'accessing - custom track header' } BioBEDFormatter >> properties [ " Use properties object to store track properties " @@ -422,12 +424,12 @@ BioBEDFormatter >> properties [ ifNil: [ properties := BioPropertyObject new ] ] -{ #category : #'accessing - custom track header' } +{ #category : 'accessing - custom track header' } BioBEDFormatter >> properties: aBioPropertyObject [ properties := aBioPropertyObject ] -{ #category : #'accessing - custom track browser' } +{ #category : 'accessing - custom track browser' } BioBEDFormatter >> setCTrackBrowserPositionChr: chrString from: startPos to: endPos [ " Add a description for custom tracks " @@ -445,7 +447,7 @@ BioBEDFormatter >> setCTrackBrowserPositionChr: chrString from: startPos to: end put: chrRange ] -{ #category : #'accessing - custom track browser' } +{ #category : 'accessing - custom track browser' } BioBEDFormatter >> setCTrackBrowserShowAll [ " Add a description for custom tracks " @@ -454,7 +456,7 @@ BioBEDFormatter >> setCTrackBrowserShowAll [ put: 'all' ] -{ #category : #'accessing - custom track header' } +{ #category : 'accessing - custom track header' } BioBEDFormatter >> setItemRgbOn [ " Set the itemRgb attribute to individually color each data line. " diff --git a/repository/BioFormatters/BioBEDGraphFormatter.class.st b/repository/BioFormatters/BioBEDGraphFormatter.class.st index 6090484a..57e2468c 100644 --- a/repository/BioFormatters/BioBEDGraphFormatter.class.st +++ b/repository/BioFormatters/BioBEDGraphFormatter.class.st @@ -4,12 +4,14 @@ transcriptome data. " Class { - #name : #BioBEDGraphFormatter, - #superclass : #BioBEDFormatter, - #category : 'BioFormatters-Formatters-BED' + #name : 'BioBEDGraphFormatter', + #superclass : 'BioBEDFormatter', + #category : 'BioFormatters-Formatters-BED', + #package : 'BioFormatters', + #tag : 'Formatters-BED' } -{ #category : #accessing } +{ #category : 'accessing' } BioBEDGraphFormatter >> fileNamePrefix [ " Answer a default prefix for the output file name " diff --git a/repository/BioFormatters/BioBigBEDFormatter.class.st b/repository/BioFormatters/BioBigBEDFormatter.class.st index 3c50571f..2286c8b1 100644 --- a/repository/BioFormatters/BioBigBEDFormatter.class.st +++ b/repository/BioFormatters/BioBigBEDFormatter.class.st @@ -7,15 +7,17 @@ bigBed format supports for very large (over 50 Mbytes) BED files. " Class { - #name : #BioBigBEDFormatter, - #superclass : #BioBEDFormatter, + #name : 'BioBigBEDFormatter', + #superclass : 'BioBEDFormatter', #instVars : [ 'dataLinesCount' ], - #category : 'BioFormatters-Formatters-BED' + #category : 'BioFormatters-Formatters-BED', + #package : 'BioFormatters', + #tag : 'Formatters-BED' } -{ #category : #accessing } +{ #category : 'accessing' } BioBigBEDFormatter >> addCFChr: chrString start: chrStart end: chrEnd [ " See superimplementor's comment. Count the lines added to the receiver " @@ -24,7 +26,7 @@ BioBigBEDFormatter >> addCFChr: chrString start: chrStart end: chrEnd [ self dataLinesCount: self dataLinesCount + 1 ] -{ #category : #accessing } +{ #category : 'accessing' } BioBigBEDFormatter >> addCFLineChr: chrString start: chrStart end: chrEnd [ " See superimplementor's comment. Count the lines added to the receiver " @@ -33,7 +35,7 @@ BioBigBEDFormatter >> addCFLineChr: chrString start: chrStart end: chrEnd [ self dataLinesCount: self dataLinesCount + 1 ] -{ #category : #accessing } +{ #category : 'accessing' } BioBigBEDFormatter >> dataLinesCount [ " Answer a with the count of the data lines in the receiver " @@ -41,12 +43,12 @@ BioBigBEDFormatter >> dataLinesCount [ ifNil: [ dataLinesCount := 0 ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioBigBEDFormatter >> dataLinesCount: anObject [ dataLinesCount := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioBigBEDFormatter >> fileNamePrefix [ " Answer a default prefix for the output file name " diff --git a/repository/BioFormatters/BioBlastCSVFormatter.class.st b/repository/BioFormatters/BioBlastCSVFormatter.class.st index 37a21438..7c6d4a77 100644 --- a/repository/BioFormatters/BioBlastCSVFormatter.class.st +++ b/repository/BioFormatters/BioBlastCSVFormatter.class.st @@ -7,47 +7,49 @@ Instance Variables: " Class { - #name : #BioBlastCSVFormatter, - #superclass : #BioCSVFormatter, + #name : 'BioBlastCSVFormatter', + #superclass : 'BioCSVFormatter', #instVars : [ 'consensus' ], - #category : #'BioFormatters-Formatters-CSV' + #category : 'BioFormatters-Formatters-CSV', + #package : 'BioFormatters', + #tag : 'Formatters-CSV' } -{ #category : #accessing } +{ #category : 'accessing' } BioBlastCSVFormatter class >> description [ " See superimplementor's comment " ^ 'CSV from Blast HIT Collection' ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastCSVFormatter class >> identifiers [ "Answer a of identifiers of the receiver" ^ #('BlastReportCSV') ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastCSVFormatter >> consensus [ ^ consensus ifNil: [ consensus := String empty ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastCSVFormatter >> consensus: anObject [ consensus := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastCSVFormatter >> export [ isValid and: [ self exportFrom: self samples ] ] -{ #category : #exporting } +{ #category : 'exporting' } BioBlastCSVFormatter >> exportConsensus [ " Private - Write a row representing the consensus sequence " @@ -59,7 +61,7 @@ BioBlastCSVFormatter >> exportConsensus [ stream cr. ] -{ #category : #exporting } +{ #category : 'exporting' } BioBlastCSVFormatter >> exportFromXML: aBlastXMLString [ " Answer the resulting formatted . Write a CSV file from aBlastXMLString" @@ -77,7 +79,7 @@ BioBlastCSVFormatter >> exportFromXML: aBlastXMLString [ ] -{ #category : #exporting } +{ #category : 'exporting' } BioBlastCSVFormatter >> exportHitCount: anInteger in: aStream [ anInteger timesRepeat: [ @@ -86,13 +88,13 @@ BioBlastCSVFormatter >> exportHitCount: anInteger in: aStream [ nextPut: $. ]. ] -{ #category : #exporting } +{ #category : 'exporting' } BioBlastCSVFormatter >> exportIdentities: aStream count: anInteger [ anInteger timesRepeat: [ aStream nextPut: $. ]. ] -{ #category : #exporting } +{ #category : 'exporting' } BioBlastCSVFormatter >> exportMatrixFromBLAST: hitCollection [ hitCollection do: [: hitNode | @@ -114,7 +116,7 @@ BioBlastCSVFormatter >> exportMatrixFromBLAST: hitCollection [ ] -{ #category : #exporting } +{ #category : 'exporting' } BioBlastCSVFormatter >> exportPositions: hitCollection [ " Private - Export a row for the sequence positions " @@ -132,20 +134,20 @@ BioBlastCSVFormatter >> exportPositions: hitCollection [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastCSVFormatter >> mutationIndexesIn: hitNode [ " Private - Answer a Collection of positions in alignmentCollection were there is a mutation " ^ hitNode selectHspMidLine indicesOfCharacter: Character space ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastCSVFormatter >> parserClass [ ^ BioNCBIBlastSAXParser ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastCSVFormatter >> sizeFrom: hitCollection [ ^ ( hitCollection size + 1 ) * ( hitCollection first selectHspAlign asNumber + 1 ) diff --git a/repository/BioFormatters/BioCSVFile.class.st b/repository/BioFormatters/BioCSVFile.class.st index 7931ae74..34e07278 100644 --- a/repository/BioFormatters/BioCSVFile.class.st +++ b/repository/BioFormatters/BioCSVFile.class.st @@ -16,31 +16,33 @@ myCsv ignoreLastLines. myCsv ignoreLinesCount: 3. " Class { - #name : #BioCSVFile, - #superclass : #BioFile, + #name : 'BioCSVFile', + #superclass : 'BioFile', #instVars : [ 'ignoreLinesStrategy', 'ignoreLinesCount', 'lines' ], - #category : 'BioFormatters-Formatters-CSV' + #category : 'BioFormatters-Formatters-CSV', + #package : 'BioFormatters', + #tag : 'Formatters-CSV' } -{ #category : #testing } +{ #category : 'testing' } BioCSVFile class >> isValidFile: aFilename [ " Answer if aFilename is valid for the receiver " ^ (super isValidFile: aFilename) and: [ aFilename endsWith: '.csv' ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioCSVFile class >> possibleExtensions [ " See superimplementor's comment" ^ self fileFormatterClass fileExtensionsFor: 'CSV' ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioCSVFile >> defaultIgnoreLinesStrategy [ " Set the receiver's read strategy to skip headers " @@ -48,39 +50,39 @@ BioCSVFile >> defaultIgnoreLinesStrategy [ ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioCSVFile >> ignoreFirstLines [ ignoreLinesStrategy := #ignoreHeadersCount: ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioCSVFile >> ignoreLastLines [ ignoreLinesStrategy := #ignoreLastLinesCount: ] -{ #category : #accessing } +{ #category : 'accessing' } BioCSVFile >> ignoreLinesCount [ ^ ignoreLinesCount ] -{ #category : #accessing } +{ #category : 'accessing' } BioCSVFile >> ignoreLinesCount: anObject [ ignoreLinesCount := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioCSVFile >> ignoreLinesStrategy [ ^ ignoreLinesStrategy ] -{ #category : #accessing } +{ #category : 'accessing' } BioCSVFile >> ignoreLinesStrategy: anObject [ ignoreLinesStrategy := anObject ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioCSVFile >> initialize [ " Private - Initialize the receiver's default parameters " @@ -90,7 +92,7 @@ BioCSVFile >> initialize [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioCSVFile >> lines [ " Answer the number of lines in the receiver " @@ -98,7 +100,7 @@ BioCSVFile >> lines [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioCSVFile >> lines: anInteger [ " For efficency reasons, instead of counting the lines in the receiver, set the number manually to anInteger " diff --git a/repository/BioFormatters/BioCSVFileCollection.class.st b/repository/BioFormatters/BioCSVFileCollection.class.st index fa6f8226..6c2ec237 100644 --- a/repository/BioFormatters/BioCSVFileCollection.class.st +++ b/repository/BioFormatters/BioCSVFileCollection.class.st @@ -9,12 +9,14 @@ this way contained CSV files can be manipulated through specific methods in BioC " Class { - #name : #BioCSVFileCollection, - #superclass : #BioFileCollection, - #category : 'BioFormatters-Core' + #name : 'BioCSVFileCollection', + #superclass : 'BioFileCollection', + #category : 'BioFormatters-Core', + #package : 'BioFormatters', + #tag : 'Core' } -{ #category : #accessing } +{ #category : 'accessing' } BioCSVFileCollection class >> fileClass [ " See superimplementor's comment " diff --git a/repository/BioFormatters/BioCSVFormatter.class.st b/repository/BioFormatters/BioCSVFormatter.class.st index 24d820c5..ff673dd4 100644 --- a/repository/BioFormatters/BioCSVFormatter.class.st +++ b/repository/BioFormatters/BioCSVFormatter.class.st @@ -3,33 +3,35 @@ Abstract class for CSV format writers " Class { - #name : #BioCSVFormatter, - #superclass : #BioFileFormatter, - #category : #'BioFormatters-Formatters-CSV' + #name : 'BioCSVFormatter', + #superclass : 'BioFileFormatter', + #category : 'BioFormatters-Formatters-CSV', + #package : 'BioFormatters', + #tag : 'Formatters-CSV' } -{ #category : #accessing } +{ #category : 'accessing' } BioCSVFormatter class >> description [ " See superimplementor's comment " ^ 'Generic CSV' ] -{ #category : #accessing } +{ #category : 'accessing' } BioCSVFormatter class >> formatExtension [ "Answer a corresponding for the receiver's file output format" ^ 'csv' ] -{ #category : #accessing } +{ #category : 'accessing' } BioCSVFormatter class >> identifiers [ "Answer a of identifiers of the receiver" ^ #('CSV' 'Comma Separated Values' 'Comma Delimited File' 'Tab Delimited File') ] -{ #category : #accessing } +{ #category : 'accessing' } BioCSVFormatter >> exportFrom: aCollection [ " Iterate aCollection storing the corresponding CSV format for each item. Output the resulting stream in a new timestamped file in the receiver's directory " @@ -42,14 +44,14 @@ BioCSVFormatter >> exportFrom: aCollection [ contents: stream contents ] -{ #category : #accessing } +{ #category : 'accessing' } BioCSVFormatter >> fileNamePrefix [ " Answer a default prefix for the output file name " ^ 'BioST-Export-CSV_' ] -{ #category : #accessing } +{ #category : 'accessing' } BioCSVFormatter >> newParserFor: filePath [ " Answer a new CSV parser " @@ -58,14 +60,14 @@ BioCSVFormatter >> newParserFor: filePath [ yourself ] -{ #category : #accessing } +{ #category : 'accessing' } BioCSVFormatter >> parserClass [ " Answer a default parser class " ^ NeoCSVReader ] -{ #category : #accessing } +{ #category : 'accessing' } BioCSVFormatter >> parserOn: aString [ ^ (self parserClass on: (ReadStream on: aString)) @@ -74,7 +76,7 @@ BioCSVFormatter >> parserOn: aString [ yourself. ] -{ #category : #accessing } +{ #category : 'accessing' } BioCSVFormatter >> validate: aCollection [ " See superimplementor's comment " diff --git a/repository/BioFormatters/BioContractionNaming.class.st b/repository/BioFormatters/BioContractionNaming.class.st index 308307be..430ae43c 100644 --- a/repository/BioFormatters/BioContractionNaming.class.st +++ b/repository/BioFormatters/BioContractionNaming.class.st @@ -7,36 +7,38 @@ this is useful for programs which have limits in the samples names. " Class { - #name : #BioContractionNaming, - #superclass : #BioNaming, + #name : 'BioContractionNaming', + #superclass : 'BioNaming', #instVars : [ 'contractionLimit', 'capitalize', 'skipStopWords' ], - #category : 'BioFormatters-Naming' + #category : 'BioFormatters-Naming', + #package : 'BioFormatters', + #tag : 'Naming' } -{ #category : #accessing } +{ #category : 'accessing' } BioContractionNaming >> capitalize [ ^ capitalize ] -{ #category : #accessing } +{ #category : 'accessing' } BioContractionNaming >> contractionLimit [ ^ contractionLimit ] -{ #category : #accessing } +{ #category : 'accessing' } BioContractionNaming >> contractionLimit: anObject [ contractionLimit := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioContractionNaming >> format: aString [ " Answer a String from contracting first letters from aString " @@ -52,7 +54,7 @@ BioContractionNaming >> format: aString [ ^ result. ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioContractionNaming >> initialize [ " Private - Set receiver's default settings " @@ -63,24 +65,24 @@ BioContractionNaming >> initialize [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioContractionNaming >> setCapitalization [ " Set the receiver to capitalize the formatting result " capitalize := true ] -{ #category : #accessing } +{ #category : 'accessing' } BioContractionNaming >> skipStopWords [ ^ skipStopWords ] -{ #category : #accessing } +{ #category : 'accessing' } BioContractionNaming >> skipStopWords: anObject [ skipStopWords := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioContractionNaming >> unsetCapitalization [ " Set the receiver to not capitalize the formatting result " diff --git a/repository/BioFormatters/BioEIGENSTRATWriter.class.st b/repository/BioFormatters/BioEIGENSTRATWriter.class.st index f729c502..9b62c83d 100644 --- a/repository/BioFormatters/BioEIGENSTRATWriter.class.st +++ b/repository/BioFormatters/BioEIGENSTRATWriter.class.st @@ -25,8 +25,8 @@ It uses two parsers: One for the PED fie, used to fill the genotype matrix and a " Class { - #name : #BioEIGENSTRATWriter, - #superclass : #BioMatrixFormatter, + #name : 'BioEIGENSTRATWriter', + #superclass : 'BioMatrixFormatter', #instVars : [ 'alleleFqs', 'strName', @@ -35,17 +35,19 @@ Class { 'markers', 'genoMatrix' ], - #category : #'BioFormatters-Formatters' + #category : 'BioFormatters-Formatters', + #package : 'BioFormatters', + #tag : 'Formatters' } -{ #category : #accessing } +{ #category : 'accessing' } BioEIGENSTRATWriter class >> description [ " See superimplementor's comment " ^ 'EIGENSOFT Eigenstrat Formatter/Writer' ] -{ #category : #examples } +{ #category : 'examples' } BioEIGENSTRATWriter class >> example1 [ | snpWriter pedFile alleleFqs | @@ -62,13 +64,13 @@ BioEIGENSTRATWriter class >> example1 [ snpWriter writeAsEigenStrat. ] -{ #category : #examples } +{ #category : 'examples' } BioEIGENSTRATWriter class >> testFilesFullDirectoryName [ ^ super testFilesFullDirectoryName / 'eigenstrat' ] -{ #category : #accessing } +{ #category : 'accessing' } BioEIGENSTRATWriter >> alPositionsForMarker: a1 [ " Answer a of allele positions for marker position a1 " @@ -76,18 +78,18 @@ BioEIGENSTRATWriter >> alPositionsForMarker: a1 [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioEIGENSTRATWriter >> alleleFqs [ ^ alleleFqs ] -{ #category : #accessing } +{ #category : 'accessing' } BioEIGENSTRATWriter >> alleleFqs: aFileReference [ alleleFqs := aFileReference ] -{ #category : #exporting } +{ #category : 'exporting' } BioEIGENSTRATWriter >> exportCellDelimiter [ " Private - See superimplementor's comment " @@ -95,7 +97,7 @@ BioEIGENSTRATWriter >> exportCellDelimiter [ ifFalse: [ self outputFileStream nextPut: Character tab ]. ] -{ #category : #private } +{ #category : 'private' } BioEIGENSTRATWriter >> fillGenotypeCellAlleles: alArray allelePosition: alPos row: currentGenoRow col: currentGenoCol [ alArray do: [ : allele | @@ -110,7 +112,7 @@ BioEIGENSTRATWriter >> fillGenotypeCellAlleles: alArray allelePosition: alPos ro put: genoValue ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioEIGENSTRATWriter >> fillGenotypeMatrix [ | parserForPed | @@ -120,7 +122,7 @@ BioEIGENSTRATWriter >> fillGenotypeMatrix [ ^ self genoMatrix ] -{ #category : #accessing } +{ #category : 'accessing' } BioEIGENSTRATWriter >> fillGenotypeMatrixFrom: parserForPed [ | currentGenoCol | @@ -149,7 +151,7 @@ BioEIGENSTRATWriter >> fillGenotypeMatrixFrom: parserForPed [ currentGenoCol := currentGenoCol + 1 ]. ] -{ #category : #private } +{ #category : 'private' } BioEIGENSTRATWriter >> fillSNPMatrix [ " Private - Write the receiver's SNP output matrix (this is the .snp or .map file)" @@ -159,7 +161,7 @@ BioEIGENSTRATWriter >> fillSNPMatrix [ ] -{ #category : #private } +{ #category : 'private' } BioEIGENSTRATWriter >> fillSNPMatrixPosition: gPos [ " Private - Write SNP matrix current row with gPos values " @@ -171,7 +173,7 @@ BioEIGENSTRATWriter >> fillSNPMatrixPosition: gPos [ at: rowIndex at: 6 put: $2. ] -{ #category : #private } +{ #category : 'private' } BioEIGENSTRATWriter >> fillSNPMatrixSTRName: row [ " Private - Append separator between SNP or Microsatellite name and allele number at current row " @@ -185,7 +187,7 @@ BioEIGENSTRATWriter >> fillSNPMatrixSTRName: row [ ] -{ #category : #private } +{ #category : 'private' } BioEIGENSTRATWriter >> fillSNPMatrixSTRNameColumn [ " Private - Configure the parser for allele frequencies as produced from MSTools. Set the SNP matrix values accordingly " @@ -199,7 +201,7 @@ BioEIGENSTRATWriter >> fillSNPMatrixSTRNameColumn [ ] -{ #category : #private } +{ #category : 'private' } BioEIGENSTRATWriter >> fillSNPMatrixSTRPositions [ rowIndex := 0. @@ -210,7 +212,7 @@ BioEIGENSTRATWriter >> fillSNPMatrixSTRPositions [ ] -{ #category : #private } +{ #category : 'private' } BioEIGENSTRATWriter >> fillSNPMatrixSTRPositions: currentStrname [ | gPos | @@ -224,17 +226,17 @@ BioEIGENSTRATWriter >> fillSNPMatrixSTRPositions: currentStrname [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioEIGENSTRATWriter >> genoMatrix [ ^ genoMatrix ] -{ #category : #accessing } +{ #category : 'accessing' } BioEIGENSTRATWriter >> genoMatrix: anObject [ genoMatrix := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioEIGENSTRATWriter >> genotypeArrayAt: row a1: a1 a2: a2 [ " Answer array values at position a1 and a2 in row " @@ -247,7 +249,7 @@ BioEIGENSTRATWriter >> genotypeArrayAt: row a1: a1 a2: a2 [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioEIGENSTRATWriter >> genotypeValueAt: alArray [ " 0 means zero copies of reference allele. @@ -269,7 +271,7 @@ BioEIGENSTRATWriter >> genotypeValueAt: alArray [ ] -{ #category : #private } +{ #category : 'private' } BioEIGENSTRATWriter >> includesAlleleFrq: aRow [ " Private - Answer if aRow is valid and contains allele frequency data " @@ -279,13 +281,13 @@ BioEIGENSTRATWriter >> includesAlleleFrq: aRow [ ^ locus notNil and: [ locus first isLetter not ] ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioEIGENSTRATWriter >> initialize [ rowIndex := 0. ] -{ #category : #accessing } +{ #category : 'accessing' } BioEIGENSTRATWriter >> initializeMarkers [ markers := OrderPreservingDictionary new. @@ -299,13 +301,13 @@ BioEIGENSTRATWriter >> initializeMarkers [ ifAbsent: [ (markers at: markerName ifAbsentPut: [OrderedCollection new]) add: markerAl ] ] ]. ] -{ #category : #private } +{ #category : 'private' } BioEIGENSTRATWriter >> isLocusName: aRow [ ^ aRow first notNil and: [ aRow first first isLetter ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioEIGENSTRATWriter >> markers [ ^ markers @@ -313,7 +315,7 @@ BioEIGENSTRATWriter >> markers [ markers ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioEIGENSTRATWriter >> newGenotypeMatrix: parserForPed [ " Answer a new matrix initialized from parserForPed settings. Matrix is initialized with all 0's. " @@ -327,14 +329,14 @@ BioEIGENSTRATWriter >> newGenotypeMatrix: parserForPed [ element: 0. ] -{ #category : #private } +{ #category : 'private' } BioEIGENSTRATWriter >> parserClass [ " Answer a default parser class " ^ NeoCSVReader ] -{ #category : #accessing } +{ #category : 'accessing' } BioEIGENSTRATWriter >> pedFile [ " Answer a of the input PED file : PED format details: @@ -354,14 +356,14 @@ BioEIGENSTRATWriter >> pedFile [ ^ self inputFile ] -{ #category : #accessing } +{ #category : 'accessing' } BioEIGENSTRATWriter >> pedFile: fileReference [ " Set fileReference to the input PED file " self inputFile: fileReference ] -{ #category : #private } +{ #category : 'private' } BioEIGENSTRATWriter >> preallocateMatrix [ | rows | @@ -372,7 +374,7 @@ BioEIGENSTRATWriter >> preallocateMatrix [ self initMatrixRows: rows columns: 6. ] -{ #category : #private } +{ #category : 'private' } BioEIGENSTRATWriter >> setParserForAlleleFqs [ self parser: (self parserClass on: (BioObject openFullFileNamed: self alleleFqs)). @@ -383,7 +385,7 @@ BioEIGENSTRATWriter >> setParserForAlleleFqs [ ] -{ #category : #private } +{ #category : 'private' } BioEIGENSTRATWriter >> setParserForPed [ self parser: (self parserClass on: (BioObject openFullFileNamed: self pedFile)). @@ -392,17 +394,17 @@ BioEIGENSTRATWriter >> setParserForPed [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioEIGENSTRATWriter >> strName [ ^ strName ] -{ #category : #accessing } +{ #category : 'accessing' } BioEIGENSTRATWriter >> strName: anObject [ strName := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioEIGENSTRATWriter >> writeAsEigenStrat [ " Write the receiver's input files in EigenStrat format " diff --git a/repository/BioFormatters/BioFASTAFile.class.st b/repository/BioFormatters/BioFASTAFile.class.st index 8d5d2030..004d2c89 100644 --- a/repository/BioFormatters/BioFASTAFile.class.st +++ b/repository/BioFormatters/BioFASTAFile.class.st @@ -11,19 +11,21 @@ myFasta contents. " Class { - #name : #BioFASTAFile, - #superclass : #BioFile, - #category : #'BioFormatters-Formatters-FASTA' + #name : 'BioFASTAFile', + #superclass : 'BioFile', + #category : 'BioFormatters-Formatters-FASTA', + #package : 'BioFormatters', + #tag : 'Formatters-FASTA' } -{ #category : #accessing } +{ #category : 'accessing' } BioFASTAFile class >> possibleExtensions [ " See superimplementor's comment" ^ self fileFormatterClass fileExtensionsFor: 'FASTA' ] -{ #category : #accessing } +{ #category : 'accessing' } BioFASTAFile >> contents [ " Answer receiver's contents " diff --git a/repository/BioFormatters/BioFASTAFileCollection.class.st b/repository/BioFormatters/BioFASTAFileCollection.class.st index d5580235..3d8c5350 100644 --- a/repository/BioFormatters/BioFASTAFileCollection.class.st +++ b/repository/BioFormatters/BioFASTAFileCollection.class.st @@ -11,12 +11,14 @@ this way, contained FASTA files can be manipulated through specific methods in ` " Class { - #name : #BioFASTAFileCollection, - #superclass : #BioFileCollection, - #category : #'BioFormatters-Formatters-FASTA' + #name : 'BioFASTAFileCollection', + #superclass : 'BioFileCollection', + #category : 'BioFormatters-Formatters-FASTA', + #package : 'BioFormatters', + #tag : 'Formatters-FASTA' } -{ #category : #accessing } +{ #category : 'accessing' } BioFASTAFileCollection class >> fileClass [ " See superimplementor's comment " diff --git a/repository/BioFormatters/BioFASTAFormatter.class.st b/repository/BioFormatters/BioFASTAFormatter.class.st index 25284a82..e74b8ecf 100644 --- a/repository/BioFormatters/BioFASTAFormatter.class.st +++ b/repository/BioFormatters/BioFASTAFormatter.class.st @@ -4,19 +4,21 @@ Format writer for FASTA objects. See class side for examples " Class { - #name : #BioFASTAFormatter, - #superclass : #BioFileFormatter, - #category : #'BioFormatters-Formatters-FASTA' + #name : 'BioFASTAFormatter', + #superclass : 'BioFileFormatter', + #category : 'BioFormatters-Formatters-FASTA', + #package : 'BioFormatters', + #tag : 'Formatters-FASTA' } -{ #category : #accessing } +{ #category : 'accessing' } BioFASTAFormatter class >> description [ " See superimplementor's comment " ^ 'FASTA Writer' ] -{ #category : #examples } +{ #category : 'examples' } BioFASTAFormatter class >> example01 [ " The following example shows how to create a collection of fasta records and write them to a FASTA timestamped file " @@ -30,21 +32,21 @@ TAATATGCCTATGCCGCATAATTTTTATATCTTTCTCCTAACAAAACATTCGCTTGTAAA'); BioFASTAFormatter new exportFrom: fastaCollection sequences. ] -{ #category : #accessing } +{ #category : 'accessing' } BioFASTAFormatter class >> formatExtension [ "Answer a corresponding for the receiver's file output format" ^ 'fasta' ] -{ #category : #accessing } +{ #category : 'accessing' } BioFASTAFormatter class >> identifiers [ "Answer a of identifiers of the receiver" ^ #('FASTA') ] -{ #category : #exporting } +{ #category : 'exporting' } BioFASTAFormatter >> dumpFeatureData: featureDictionary groupingFeature: aString [ self stream @@ -55,7 +57,7 @@ BioFASTAFormatter >> dumpFeatureData: featureDictionary groupingFeature: aString bioCr ] -{ #category : #accessing } +{ #category : 'accessing' } BioFASTAFormatter >> exportFrom: aCollectionOrStream [ " Write aCollection to the receiver's output file name " @@ -73,7 +75,7 @@ BioFASTAFormatter >> exportFrom: aCollectionOrStream [ ] -{ #category : #exporting } +{ #category : 'exporting' } BioFASTAFormatter >> exportFromBLAST: hitCollection [ " Write a time-stamped file in the receiver's format from hitCollecction " @@ -93,7 +95,7 @@ BioFASTAFormatter >> exportFromBLAST: hitCollection [ ] -{ #category : #exporting } +{ #category : 'exporting' } BioFASTAFormatter >> exportFromIlluminaAlleleReport: aFilename [ "Write a time-stamped file in the receiver's format from aFilename" @@ -119,7 +121,7 @@ BioFASTAFormatter >> exportFromIlluminaAlleleReport: aFilename [ fs close. ] -{ #category : #accessing } +{ #category : 'accessing' } BioFASTAFormatter >> exportFromReader: aBioReader [ " Export recceiver to a file using aBioReader " @@ -127,14 +129,14 @@ BioFASTAFormatter >> exportFromReader: aBioReader [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioFASTAFormatter >> fileNamePrefix [ " Answer a String for prefixing the output file name " ^ 'BioST-Exported-FASTA_' ] -{ #category : #accessing } +{ #category : 'accessing' } BioFASTAFormatter >> formatExtension [ "Answer a corresponding for the receiver's file output format" @@ -142,19 +144,19 @@ BioFASTAFormatter >> formatExtension [ ] -{ #category : #exporting } +{ #category : 'exporting' } BioFASTAFormatter >> parserClass [ ^ NeoCSVReader ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioFASTAFormatter >> sizeFrom: collection [ ^ collection sum: [: d | d sum: #size ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioFASTAFormatter >> validate: aCollection [ " See superimplementor's comment " @@ -164,7 +166,7 @@ BioFASTAFormatter >> validate: aCollection [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioFASTAFormatter >> writeClassifiedRowsFrom: data [ " Private - Assume data is a with each Association a pair -> features contain all possible features in data. if data at specific feature is absent, then use a dash to specify null value " diff --git a/repository/BioFormatters/BioFile.class.st b/repository/BioFormatters/BioFile.class.st index c696c982..2e80386c 100644 --- a/repository/BioFormatters/BioFile.class.st +++ b/repository/BioFormatters/BioFile.class.st @@ -5,55 +5,57 @@ A BioFormatter is what to use when a developer has an INPUT file and possible an " Class { - #name : #BioFile, - #superclass : #BioNamedObject, + #name : 'BioFile', + #superclass : 'BioNamedObject', #instVars : [ 'stream' ], - #category : 'BioFormatters-Core' + #category : 'BioFormatters-Core', + #package : 'BioFormatters', + #tag : 'Core' } -{ #category : #accessing } +{ #category : 'accessing' } BioFile class >> fileFormatterClass [ ^ BioFileFormat ] -{ #category : #testing } +{ #category : 'testing' } BioFile class >> isValidFile: aFilename [ " Answer if aFilename is valid for the receiver " ^ aFilename notNil and: [ aFilename notEmpty ] ] -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioFile class >> on: anObject [ " Answer a new instance of the receiver for the given anObject " ^ self new initializeWith: anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioFile >> close [ "Close the receiver's file." self stream close ] -{ #category : #accessing } +{ #category : 'accessing' } BioFile >> contents [ "Answer all of the contents of the receiver." ^ self stream contents ] -{ #category : #accessing } +{ #category : 'accessing' } BioFile >> fileFormatterClass [ ^ self class fileFormatterClass ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioFile >> initializeWith: aFilePathOrFileStream [ " Private - Check and open aFilePathOrFileStream " @@ -65,14 +67,14 @@ BioFile >> initializeWith: aFilePathOrFileStream [ self name: fStream name ] -{ #category : #accessing } +{ #category : 'accessing' } BioFile >> possibleExtensions [ " See class comment " ^ self class possibleExtensions ] -{ #category : #printing } +{ #category : 'printing' } BioFile >> printOn: aStream [ " Private - See superimplementor's comment " @@ -81,13 +83,13 @@ BioFile >> printOn: aStream [ between: $[ and: $] ] -{ #category : #accessing } +{ #category : 'accessing' } BioFile >> stream [ ^ stream ] -{ #category : #accessing } +{ #category : 'accessing' } BioFile >> stream: anObject [ stream := anObject ] diff --git a/repository/BioFormatters/BioFileFormat.class.st b/repository/BioFormatters/BioFileFormat.class.st index 28b0f5f0..89a602ab 100644 --- a/repository/BioFormatters/BioFileFormat.class.st +++ b/repository/BioFormatters/BioFileFormat.class.st @@ -17,8 +17,8 @@ http://assets.geneious.com/manual/8.0/GeneiousManualse15.html " Class { - #name : #BioFileFormat, - #superclass : #BioNamedObject, + #name : 'BioFileFormat', + #superclass : 'BioNamedObject', #instVars : [ 'description', 'extensions', @@ -29,10 +29,12 @@ Class { #classVars : [ 'Registry' ], - #category : 'BioFormatters-Files' + #category : 'BioFormatters-Files', + #package : 'BioFormatters', + #tag : 'Files' } -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormat class >> fileExtensionFor: aFormatString [ " Answer a String corresponding aFormatString in the receiver's registry " @@ -41,7 +43,7 @@ BioFileFormat class >> fileExtensionFor: aFormatString [ ^ (self fileExtensionsFor: aFormatString) anyOne ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormat class >> fileExtensionsFor: aFormatString [ | fmt | @@ -52,7 +54,7 @@ BioFileFormat class >> fileExtensionsFor: aFormatString [ ^ fmt extensions ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormat class >> formatFor: aString [ " Answer a in the receiver's registry matching aString. Signal an exception if not found " @@ -66,7 +68,7 @@ BioFileFormat class >> formatFor: aString [ ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioFileFormat class >> formatsCollection [ " Answer a Collection with information about well-known file formats. See http://www.bioperl.org/wiki/HOWTO:SeqIO for details BioFileFormat formatCollection " @@ -391,7 +393,7 @@ BioFileFormat class >> formatsCollection [ ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioFileFormat class >> initialize [ " Private - Initialize receiver's file formats. self initialize " @@ -406,7 +408,7 @@ BioFileFormat class >> initialize [ rootClass: formatSpec fourth ] ] -{ #category : #testing } +{ #category : 'testing' } BioFileFormat class >> isRegistered: aString [ " Search aString in the receiver's registered names and descriptions. Answer if found " @@ -415,7 +417,7 @@ BioFileFormat class >> isRegistered: aString [ ifNone: [ nil ]) notNil ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormat class >> registerFormat: nameString extensions: aCollection description: descriptionString rootClass: aClass [ " Create a new format and register in the receiver if not present " @@ -431,7 +433,7 @@ BioFileFormat class >> registerFormat: nameString extensions: aCollection descri ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormat class >> registry [ " Answer a of " @@ -439,14 +441,14 @@ BioFileFormat class >> registry [ ifNil: [ Registry := OrderedCollection new ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormat class >> registry: aCollectionOfBioFileFormat [ " Set the receiver's registry of file formats to aCollection of " Registry := aCollectionOfBioFileFormat ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormat class >> removeFormat: nameString [ " Remove the format nameString if found from the receiver's registry " @@ -457,44 +459,44 @@ BioFileFormat class >> removeFormat: nameString [ ifAbsent: [ self signalNotFound: nameString ] ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormat >> compatibleFormats [ ^ compatibleFormats ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormat >> compatibleFormats: anObject [ compatibleFormats := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormat >> description [ ^ description ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormat >> description: anObject [ description := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormat >> extensions [ ^ extensions ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormat >> extensions: anObject [ extensions := anObject ] -{ #category : #testing } +{ #category : 'testing' } BioFileFormat >> includesExtension: aString [ " Answer if receiver is represented as file with extension aString " ^ (self extensions collect: #asLowercase) includes: aString asLowercase ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormat >> includesName: aString [ " Answer if receiver contains aString in any of its names " @@ -507,7 +509,7 @@ BioFileFormat >> includesName: aString [ ^ false ] -{ #category : #printing } +{ #category : 'printing' } BioFileFormat >> printOn: aStream [ " See superimplementor's comment " @@ -526,22 +528,22 @@ BioFileFormat >> printOn: aStream [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormat >> rootClass [ ^ rootClass ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormat >> rootClass: anObject [ rootClass := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormat >> sampleEntry [ ^ sampleEntry ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormat >> sampleEntry: anObject [ sampleEntry := anObject ] diff --git a/repository/BioFormatters/BioFileFormatter.class.st b/repository/BioFormatters/BioFileFormatter.class.st index 819f8ee7..b612d522 100644 --- a/repository/BioFormatters/BioFileFormatter.class.st +++ b/repository/BioFormatters/BioFileFormatter.class.st @@ -11,8 +11,8 @@ Instance Variables: writeToFile If then write the output to a file " Class { - #name : #BioFileFormatter, - #superclass : #BioFormatter, + #name : 'BioFileFormatter', + #superclass : 'BioFormatter', #instVars : [ 'inputFile', 'outputFilename', @@ -22,24 +22,26 @@ Class { 'cwd', 'outputFileStream' ], - #category : #'BioFormatters-Formatters' + #category : 'BioFormatters-Formatters', + #package : 'BioFormatters', + #tag : 'Formatters' } -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormatter class >> identifier [ " Answer a of an unique identifier for the receiver " ^ self identifiers first ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormatter class >> identifiers [ " Answer a of identifiers of the receiver. The first identifier should match with an identifier in the #formatCollection to be available for file exporting " ^ Array empty ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormatter class >> linesCount: aFilename [ " Answer a how many lines contains aFilename" @@ -51,14 +53,14 @@ BioFileFormatter class >> linesCount: aFilename [ count ] ] -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioFileFormatter class >> newFromInputFile: aFilenameOrFileReference [ " Set the receiver's input file to be aFilename " ^ self new inputFile: aFilenameOrFileReference ] -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioFileFormatter class >> newFromInputFile: inputFile outputFile: outFilename [ " Answer a new instance of the receiver with a BioFile and outFilename " ^ self new @@ -67,7 +69,7 @@ BioFileFormatter class >> newFromInputFile: inputFile outputFile: outFilename [ yourself ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormatter >> cwd [ " Answer a representing the Current working directory " @@ -75,28 +77,28 @@ BioFileFormatter >> cwd [ ifNil: [ cwd := self defaultCwd ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormatter >> cwd: aString [ " Set aString to be the current working directory " cwd := aString ] -{ #category : #defaults } +{ #category : 'defaults' } BioFileFormatter >> defaultCwd [ " Answer a representing the default current working directory " ^ '.' ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormatter >> delimiter [ " Answer the used to delimit fields " self subclassResponsibility ] -{ #category : #'convenience-filesystem' } +{ #category : 'convenience-filesystem' } BioFileFormatter >> dumpToFileNamed: aFilename contents: contentsString [ " See superimplementor's comment " @@ -104,7 +106,7 @@ BioFileFormatter >> dumpToFileNamed: aFilename contents: contentsString [ ifTrue: [ super dumpToFileNamed: aFilename contents: contentsString ]. ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormatter >> export [ " Write contents to receiver's output file " @@ -113,14 +115,14 @@ BioFileFormatter >> export [ ifTrue: [ self exportFrom: self samples ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormatter >> flush [ " Write to disk " self outputFileStream flush; close. ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormatter >> formatExtension [ " Private - Answer a String corresponding for the receiver's file output format " @@ -128,14 +130,14 @@ BioFileFormatter >> formatExtension [ ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioFileFormatter >> initializeStream: collection [ " Private - Preallocate collection initial size " stream := ReadWriteStream on: String new. ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormatter >> inputFile [ " Answer a with the file name of the input file. If cwd is set, then prepend its value to inputFile, otherwise just answer input file value " @@ -148,38 +150,38 @@ BioFileFormatter >> inputFile [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormatter >> inputFile: aString [ " Set the receiver's input file path to be aString " inputFile := aString ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormatter >> inputStream [ ^ inputStream ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormatter >> inputStream: anObject [ inputStream := anObject ] -{ #category : #testing } +{ #category : 'testing' } BioFileFormatter >> isValidForExport: aCollection [ " Answer if aCollection is valid for exporting for the receiver " ^ aCollection notNil and: [ aCollection notEmpty ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormatter >> linesCount: aFilename [ " Answer a how many lines contains aFilename" ^ self class linesCount: aFilename ] -{ #category : #exporting } +{ #category : 'exporting' } BioFileFormatter >> outputFileStream [ " Answer a for a new file in the receiver's configured folder " @@ -187,14 +189,14 @@ BioFileFormatter >> outputFileStream [ ifNil: [ outputFileStream := self newFullFileNamed: (self outputFilename reversed copyUpTo: $\) reversed ]. ] -{ #category : #exporting } +{ #category : 'exporting' } BioFileFormatter >> outputFileStream: aFileStream [ " Set the receiver's output to aFileStream " ^ outputFileStream := aFileStream ] -{ #category : #exporting } +{ #category : 'exporting' } BioFileFormatter >> outputFilename [ " Private - Answer a file name for the output " @@ -205,7 +207,7 @@ BioFileFormatter >> outputFilename [ ] -{ #category : #exporting } +{ #category : 'exporting' } BioFileFormatter >> outputFilename: aString [ " Set the receiver's output file name to be aString " @@ -213,20 +215,20 @@ BioFileFormatter >> outputFilename: aString [ ] -{ #category : #exporting } +{ #category : 'exporting' } BioFileFormatter >> resetOutput [ self outputFileStream: nil. self outputFilename: nil. ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioFileFormatter >> sizeFrom: collection [ ^ collection size ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormatter >> stream [ " Answer an output for the receiver. Use output file name if set, create a new write stream otherwise " @@ -235,12 +237,12 @@ BioFileFormatter >> stream [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormatter >> stream: anObject [ stream := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormatter >> validate: aCollection [ " Iterate over aCollection. Set valid flag if all its items are valid for the receiver " @@ -251,14 +253,14 @@ BioFileFormatter >> validate: aCollection [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormatter >> writeToFile [ ^ writeToFile ifNil: [ writeToFile := true ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioFileFormatter >> writeToFile: anObject [ writeToFile := anObject ] diff --git a/repository/BioFormatters/BioFlatGenBankFormatter.class.st b/repository/BioFormatters/BioFlatGenBankFormatter.class.st index 92598f17..83bc61ae 100644 --- a/repository/BioFormatters/BioFlatGenBankFormatter.class.st +++ b/repository/BioFormatters/BioFlatGenBankFormatter.class.st @@ -1,31 +1,33 @@ Class { - #name : #BioFlatGenBankFormatter, - #superclass : #BioFileFormatter, - #category : #'BioFormatters-Formatters' + #name : 'BioFlatGenBankFormatter', + #superclass : 'BioFileFormatter', + #category : 'BioFormatters-Formatters', + #package : 'BioFormatters', + #tag : 'Formatters' } -{ #category : #accessing } +{ #category : 'accessing' } BioFlatGenBankFormatter class >> description [ " See superimplementor's comment " ^ 'GenBank Writer' ] -{ #category : #accessing } +{ #category : 'accessing' } BioFlatGenBankFormatter class >> formatExtension [ "Answer a corresponding for the receiver's file output format" ^ 'gb' ] -{ #category : #accessing } +{ #category : 'accessing' } BioFlatGenBankFormatter class >> identifiers [ "Answer a of identifiers of the receiver" ^ #('GenBank') ] -{ #category : #accessing } +{ #category : 'accessing' } BioFlatGenBankFormatter >> fileNamePrefix [ " Answer a String for prefixing the output file name " diff --git a/repository/BioFormatters/BioFluxusRDFFormatter.class.st b/repository/BioFormatters/BioFluxusRDFFormatter.class.st index 9433fd12..b59e9873 100644 --- a/repository/BioFormatters/BioFluxusRDFFormatter.class.st +++ b/repository/BioFormatters/BioFluxusRDFFormatter.class.st @@ -2,19 +2,21 @@ Fluxus Network New RDF Format Writer " Class { - #name : #BioFluxusRDFFormatter, - #superclass : #BioFileFormatter, - #category : #'BioFormatters-Formatters' + #name : 'BioFluxusRDFFormatter', + #superclass : 'BioFileFormatter', + #category : 'BioFormatters-Formatters', + #package : 'BioFormatters', + #tag : 'Formatters' } -{ #category : #accessing } +{ #category : 'accessing' } BioFluxusRDFFormatter class >> description [ " Answer a identifying the receiver's class " ^ 'Fluxus Network New RDF Format Writer' ] -{ #category : #accessing } +{ #category : 'accessing' } BioFluxusRDFFormatter class >> formatExtension [ "Answer a corresponding for the receiver's file output format" @@ -22,14 +24,14 @@ BioFluxusRDFFormatter class >> formatExtension [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioFluxusRDFFormatter class >> identifiers [ "Answer a of identifiers of the receiver" ^ #('RDF' 'RDF Windows Format' 'RDF New Format' 'Fluxus Network RDF') ] -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioFluxusRDFFormatter class >> named: aString forGroups: aClassifier [ | formatter | @@ -40,7 +42,7 @@ BioFluxusRDFFormatter class >> named: aString forGroups: aClassifier [ ^ formatter export ] -{ #category : #accessing } +{ #category : 'accessing' } BioFluxusRDFFormatter >> export [ " Write the contents to receiver's file name " @@ -56,7 +58,7 @@ BioFluxusRDFFormatter >> export [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioFluxusRDFFormatter >> exportFromAlignment: aBioAlignment [ ^ aBioAlignment do: [: seq | @@ -69,7 +71,7 @@ BioFluxusRDFFormatter >> exportFromAlignment: aBioAlignment [ cr ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioFluxusRDFFormatter >> exportHeader [ self stream @@ -77,7 +79,7 @@ BioFluxusRDFFormatter >> exportHeader [ cr ] -{ #category : #accessing } +{ #category : 'accessing' } BioFluxusRDFFormatter >> exportPositions [ 1 to: self samples anyOne size do: [: index | @@ -88,7 +90,7 @@ BioFluxusRDFFormatter >> exportPositions [ self stream cr ] -{ #category : #accessing } +{ #category : 'accessing' } BioFluxusRDFFormatter >> exportWeights [ self samples anyOne size @@ -99,14 +101,14 @@ BioFluxusRDFFormatter >> exportWeights [ self stream cr ] -{ #category : #accessing } +{ #category : 'accessing' } BioFluxusRDFFormatter >> fileNamePrefix [ " Answer a with the prefix of the output file name " ^ 'BioST-Exported-fluxus-rdf_' ] -{ #category : #accessing } +{ #category : 'accessing' } BioFluxusRDFFormatter >> frequencies [ ^ self stream diff --git a/repository/BioFormatters/BioFormatter.class.st b/repository/BioFormatters/BioFormatter.class.st index 30f6117f..cbe2017e 100644 --- a/repository/BioFormatters/BioFormatter.class.st +++ b/repository/BioFormatters/BioFormatter.class.st @@ -4,8 +4,8 @@ Abstract superclass to group common formatter (writers) behavior. Defines proper " Class { - #name : #BioFormatter, - #superclass : #BioObject, + #name : 'BioFormatter', + #superclass : 'BioObject', #instVars : [ 'parser', 'samplesCollection', @@ -14,10 +14,12 @@ Class { 'isValid', 'fileNamePrefix' ], - #category : #'BioFormatters-Core' + #category : 'BioFormatters-Core', + #package : 'BioFormatters', + #tag : 'Core' } -{ #category : #utilities } +{ #category : 'utilities' } BioFormatter class >> alphaCharacters [ " Answer a Collection with alphabetic characters " @@ -26,7 +28,7 @@ BioFormatter class >> alphaCharacters [ thenCollect: [: each | each asString ]. ] -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioFormatter class >> formatterFor: aString [ " Answer a new instance of the receiver's matching aString identifier. Examples: @@ -40,7 +42,7 @@ BioFormatter class >> formatterFor: aString [ ^ aClass new ] -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioFormatter class >> formatterForExact: aString [ " Answer the receiver's matching aString identifier. Examples: @@ -54,7 +56,7 @@ BioFormatter class >> formatterForExact: aString [ ^ aClass ] -{ #category : #utilities } +{ #category : 'utilities' } BioFormatter class >> invalidCharacters [ " Answer a Collection with Characters without visible or invalid (i.e. used for starting comments) representation " @@ -62,7 +64,7 @@ BioFormatter class >> invalidCharacters [ ^ { $# . Character space . Character tab } ] -{ #category : #utilities } +{ #category : 'utilities' } BioFormatter class >> separators [ " Answer a with descriptions of invisible characters " @@ -73,13 +75,13 @@ BioFormatter class >> separators [ yourself. ] -{ #category : #private } +{ #category : 'private' } BioFormatter >> afterExport: anObject [ " By default do nothing. This is implemented to let the receiver to perform after-export actions " ] -{ #category : #private } +{ #category : 'private' } BioFormatter >> beforeExport: anObject [ " Answer if pre-export actions are valid " @@ -87,7 +89,7 @@ BioFormatter >> beforeExport: anObject [ ] -{ #category : #'convenience-delimiters' } +{ #category : 'convenience-delimiters' } BioFormatter >> delimiterSourceCharacter [ " Answer a used to delimit fields in the receiver " @@ -95,14 +97,14 @@ BioFormatter >> delimiterSourceCharacter [ ifNil: [ delimiterSourceCharacter := $; ] ] -{ #category : #'convenience-delimiters' } +{ #category : 'convenience-delimiters' } BioFormatter >> delimiterSourceCharacter: aCharacter [ " Set the to delimit fields in the receiver source data to be aCharacter " delimiterSourceCharacter := aCharacter ] -{ #category : #'convenience-delimiters' } +{ #category : 'convenience-delimiters' } BioFormatter >> delimiterTargetCharacter [ " Answer a used to replace the receiver's delimiter in the receiver " @@ -110,19 +112,19 @@ BioFormatter >> delimiterTargetCharacter [ ifNil: [ delimiterTargetCharacter := $, ] ] -{ #category : #'convenience-delimiters' } +{ #category : 'convenience-delimiters' } BioFormatter >> delimiterTargetCharacter: anObject [ delimiterTargetCharacter := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioFormatter >> description [ " Answer a for identifying the receiver " ^ self class description ] -{ #category : #'convenience-delimiters' } +{ #category : 'convenience-delimiters' } BioFormatter >> escapeDelimiters: aString [ " Answer a replacing the receiver's #delimiter with #replacementDelimiter in aString " @@ -135,19 +137,19 @@ BioFormatter >> escapeDelimiters: aString [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioFormatter >> fileNamePrefix [ ^ fileNamePrefix ifNil: [ fileNamePrefix := String empty ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioFormatter >> fileNamePrefix: anObject [ fileNamePrefix := anObject ] -{ #category : #testing } +{ #category : 'testing' } BioFormatter >> isValid [ " Answer by default because assume receiver's was not #validate: " @@ -155,17 +157,17 @@ BioFormatter >> isValid [ ifNil: [ isValid := false ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioFormatter >> parser [ ^ parser ] -{ #category : #accessing } +{ #category : 'accessing' } BioFormatter >> parser: anObject [ parser := anObject ] -{ #category : #printing } +{ #category : 'printing' } BioFormatter >> printOn: aStream [ " Private - See superimplementor's comment " @@ -176,14 +178,14 @@ BioFormatter >> printOn: aStream [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioFormatter >> samples [ ^ samplesCollection ifNil: [ samplesCollection := OrderedCollection new ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioFormatter >> samples: aCollection [ samplesCollection := aCollection diff --git a/repository/BioFormatters/BioGBSeqCSVFormatter.class.st b/repository/BioFormatters/BioGBSeqCSVFormatter.class.st index 49892982..113d7e70 100644 --- a/repository/BioFormatters/BioGBSeqCSVFormatter.class.st +++ b/repository/BioFormatters/BioGBSeqCSVFormatter.class.st @@ -10,29 +10,31 @@ formatter interval: (16023 to: 16262). " Class { - #name : #BioGBSeqCSVFormatter, - #superclass : #BioCSVFormatter, + #name : 'BioGBSeqCSVFormatter', + #superclass : 'BioCSVFormatter', #instVars : [ 'features' ], - #category : #'BioFormatters-Formatters-CSV' + #category : 'BioFormatters-Formatters-CSV', + #package : 'BioFormatters', + #tag : 'Formatters-CSV' } -{ #category : #accessing } +{ #category : 'accessing' } BioGBSeqCSVFormatter class >> description [ " See superimplementor's comment " ^ 'CSV from Entrez GenBank Collection' ] -{ #category : #accessing } +{ #category : 'accessing' } BioGBSeqCSVFormatter class >> identifiers [ "Answer a of identifiers of the receiver" ^ #('GBSeqCSV') ] -{ #category : #accessing } +{ #category : 'accessing' } BioGBSeqCSVFormatter >> cellDataFrom: aDictionary atFeature: featureName [ ^ aDictionary @@ -40,7 +42,7 @@ BioGBSeqCSVFormatter >> cellDataFrom: aDictionary atFeature: featureName [ ifAbsent: [ '-' ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioGBSeqCSVFormatter >> dumpCellFrom: featureName cellData: cellData [ (self isExcludedFeature: featureName) @@ -50,7 +52,7 @@ BioGBSeqCSVFormatter >> dumpCellFrom: featureName cellData: cellData [ nextPut: self delimiterSourceCharacter ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioGBSeqCSVFormatter >> dumpFeatureData: aDictionary groupingFeature: ttyName [ self features @@ -63,7 +65,7 @@ BioGBSeqCSVFormatter >> dumpFeatureData: aDictionary groupingFeature: ttyName [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioGBSeqCSVFormatter >> exportFrom: aCollection [ " Export default features " @@ -76,7 +78,7 @@ BioGBSeqCSVFormatter >> exportFrom: aCollection [ self bioLog: 'Exported CSV contents in file ' , self outputFilename. ] -{ #category : #accessing } +{ #category : 'accessing' } BioGBSeqCSVFormatter >> exportFrom: data features: fCollection [ " Export data into receiver's format using features contained in fCollection " @@ -91,7 +93,7 @@ BioGBSeqCSVFormatter >> exportFrom: data features: fCollection [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioGBSeqCSVFormatter >> exportFrom: aCollection interval: interval [ self flag: #checkIfUseful. @@ -119,17 +121,17 @@ BioGBSeqCSVFormatter >> exportFrom: aCollection interval: interval [ contents: stream contents ] -{ #category : #accessing } +{ #category : 'accessing' } BioGBSeqCSVFormatter >> features [ ^ features ] -{ #category : #accessing } +{ #category : 'accessing' } BioGBSeqCSVFormatter >> features: anObject [ features := anObject ] -{ #category : #initialize } +{ #category : 'initialize' } BioGBSeqCSVFormatter >> initialize [ super initialize. @@ -137,19 +139,19 @@ BioGBSeqCSVFormatter >> initialize [ self delimiterSourceCharacter: $| ] -{ #category : #testing } +{ #category : 'testing' } BioGBSeqCSVFormatter >> isExcludedFeature: featureName [ ^ featureName = 'Recognized Region' or: [ featureName = 'BlastNode' ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioGBSeqCSVFormatter >> sizeFrom: collection [ ^ collection sum: [: d | d sum: #size ] ] -{ #category : #private } +{ #category : 'private' } BioGBSeqCSVFormatter >> writeClassifiedRowsFrom: data [ " Private - Assume data is a with each Association a pair -> features contain all possible features in data. if data at specific feature is absent, then use a dash to specify null value " @@ -161,7 +163,7 @@ BioGBSeqCSVFormatter >> writeClassifiedRowsFrom: data [ ] -{ #category : #private } +{ #category : 'private' } BioGBSeqCSVFormatter >> writeHeaderFrom: featureCollection [ " Private - Write header row from featureCollection in receiver's stream " @@ -175,7 +177,7 @@ BioGBSeqCSVFormatter >> writeHeaderFrom: featureCollection [ ] -{ #category : #private } +{ #category : 'private' } BioGBSeqCSVFormatter >> writeUnclassifiedRowsFrom: data [ " Private - Assume data is a of . features contain all possible features in data. if data at specific feature is absent, then use a dash to specify null value " diff --git a/repository/BioFormatters/BioGFF3Formatter.class.st b/repository/BioFormatters/BioGFF3Formatter.class.st index f00144eb..535c6787 100644 --- a/repository/BioFormatters/BioGFF3Formatter.class.st +++ b/repository/BioFormatters/BioGFF3Formatter.class.st @@ -7,19 +7,21 @@ The [GFF3 format](https://github.com/The-Sequence-Ontology/Specifications/blob/m " Class { - #name : #BioGFF3Formatter, - #superclass : #BioSequenceFeatureFormatter, - #category : #'BioFormatters-Formatters' + #name : 'BioGFF3Formatter', + #superclass : 'BioSequenceFeatureFormatter', + #category : 'BioFormatters-Formatters', + #package : 'BioFormatters', + #tag : 'Formatters' } -{ #category : #accessing } +{ #category : 'accessing' } BioGFF3Formatter class >> identifiers [ "Answer a of identifiers of the receiver" ^ #('GFF' 'GFF3') ] -{ #category : #converting } +{ #category : 'converting' } BioGFF3Formatter >> asString [ " Answer a representation of the receiver " @@ -42,7 +44,7 @@ BioGFF3Formatter >> asString [ nextPutAll: self sequenceFeature tag asString ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioGFF3Formatter >> delimiter [ " Answer a used to delimit fields between the receiver's elements " diff --git a/repository/BioFormatters/BioGenBankFile.class.st b/repository/BioFormatters/BioGenBankFile.class.st index 1478429f..3f852c26 100644 --- a/repository/BioFormatters/BioGenBankFile.class.st +++ b/repository/BioFormatters/BioGenBankFile.class.st @@ -1,10 +1,12 @@ Class { - #name : #BioGenBankFile, - #superclass : #BioFile, - #category : 'BioFormatters-Files' + #name : 'BioGenBankFile', + #superclass : 'BioFile', + #category : 'BioFormatters-Files', + #package : 'BioFormatters', + #tag : 'Files' } -{ #category : #accessing } +{ #category : 'accessing' } BioGenBankFile class >> possibleExtensions [ " See superimplementor's comment" diff --git a/repository/BioFormatters/BioGoogleFusionTablesFormatter.class.st b/repository/BioFormatters/BioGoogleFusionTablesFormatter.class.st index 998db29f..1675a91a 100644 --- a/repository/BioFormatters/BioGoogleFusionTablesFormatter.class.st +++ b/repository/BioFormatters/BioGoogleFusionTablesFormatter.class.st @@ -2,26 +2,28 @@ The Google Fusion Tables format is described here: http://www.google.com/drive/start/apps.html#fusiontables " Class { - #name : #BioGoogleFusionTablesFormatter, - #superclass : #BioCSVFormatter, - #category : #'BioFormatters-Formatters-CSV' + #name : 'BioGoogleFusionTablesFormatter', + #superclass : 'BioCSVFormatter', + #category : 'BioFormatters-Formatters-CSV', + #package : 'BioFormatters', + #tag : 'Formatters-CSV' } -{ #category : #accessing } +{ #category : 'accessing' } BioGoogleFusionTablesFormatter class >> description [ " See superimplementor's comment " ^ 'Google Fusion Tables Writer' ] -{ #category : #accessing } +{ #category : 'accessing' } BioGoogleFusionTablesFormatter class >> identifiers [ "Answer a of identifiers of the receiver" ^ #('Google Fusion Tables') ] -{ #category : #accessing } +{ #category : 'accessing' } BioGoogleFusionTablesFormatter >> exportFrom: aBioClassifier [ ^ super exportFrom: aBioClassifier organizationContents @@ -29,7 +31,7 @@ BioGoogleFusionTablesFormatter >> exportFrom: aBioClassifier [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioGoogleFusionTablesFormatter >> exportFrom: aCollection features: featuresCollection [ self initializeStream: aCollection. diff --git a/repository/BioFormatters/BioHaploViewFormatter.class.st b/repository/BioFormatters/BioHaploViewFormatter.class.st index 4c692b51..b2673372 100644 --- a/repository/BioFormatters/BioHaploViewFormatter.class.st +++ b/repository/BioFormatters/BioHaploViewFormatter.class.st @@ -36,22 +36,24 @@ BioHaploViewFormatter " Class { - #name : #BioHaploViewFormatter, - #superclass : #BioMatrixFormatter, + #name : 'BioHaploViewFormatter', + #superclass : 'BioMatrixFormatter', #instVars : [ 'samplesSize' ], - #category : #'BioFormatters-Formatters' + #category : 'BioFormatters-Formatters', + #package : 'BioFormatters', + #tag : 'Formatters' } -{ #category : #accessing } +{ #category : 'accessing' } BioHaploViewFormatter class >> description [ " Private - See superimplementor's comment " ^ 'HaploView Writer' ] -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioHaploViewFormatter class >> folder: aDirectoryString newOnInputFiles: inputFilenamesWithAffectedRows samples: aSamplesCollection affectionStatuses: affectionStatuses [ inputFilenamesWithAffectedRows associationsDo: [ : assoc | @@ -72,14 +74,14 @@ BioHaploViewFormatter class >> folder: aDirectoryString newOnInputFiles: inputFi exportMatrix ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioHaploViewFormatter class >> identifiers [ " Answer a of identifiers of the receiver " ^ #('HaploView' 'Linkage Desequilibrium' 'Genehunter''s TDT') ] -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioHaploViewFormatter class >> newOnInputFile: anInputFilename outputFile: anOutputFilename samples: aSamplesCollection affectedRows: affectedRowsCount [ ^ self new @@ -89,7 +91,7 @@ BioHaploViewFormatter class >> newOnInputFile: anInputFilename outputFile: anOut affectedRows: affectedRowsCount ] -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioHaploViewFormatter class >> readFromCsv: csvFilename [ " The case for the following example is an output file sent by Illumina and you want to export to HaploView format by chromosome. @@ -107,21 +109,21 @@ BioHaploViewFormatter class >> readFromCsv: csvFilename [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioHaploViewFormatter >> delimiter [ " See superimplementor's comment " ^ Character tab ] -{ #category : #accessing } +{ #category : 'accessing' } BioHaploViewFormatter >> delimiterSourceCharacter [ " See superimplementor's comment " ^ Character tab ] -{ #category : #exporting } +{ #category : 'exporting' } BioHaploViewFormatter >> exportCellAtRow: rIndex atColumn: cIndex [ " Write the receiver's matrix cell content at rIndex and cIndex position " @@ -130,7 +132,7 @@ BioHaploViewFormatter >> exportCellAtRow: rIndex atColumn: cIndex [ tab ] -{ #category : #populating } +{ #category : 'populating' } BioHaploViewFormatter >> fillAffectionStatus: aValue [ " Private - Refer to the HaploView documentation for details " @@ -142,7 +144,7 @@ BioHaploViewFormatter >> fillAffectionStatus: aValue [ ] -{ #category : #populating } +{ #category : 'populating' } BioHaploViewFormatter >> fillFatherIDs: aValue [ " Private - Refer to the HaploView documentation for details " @@ -153,7 +155,7 @@ BioHaploViewFormatter >> fillFatherIDs: aValue [ ] -{ #category : #populating } +{ #category : 'populating' } BioHaploViewFormatter >> fillIndividualIDs [ " Private - Refer to the HaploView documentation for details " @@ -164,7 +166,7 @@ BioHaploViewFormatter >> fillIndividualIDs [ ] -{ #category : #populating } +{ #category : 'populating' } BioHaploViewFormatter >> fillMatrix [ " Private - Matrix with nucleotide data in HaploView file format begins from the 7th column " @@ -181,7 +183,7 @@ BioHaploViewFormatter >> fillMatrix [ ] -{ #category : #populating } +{ #category : 'populating' } BioHaploViewFormatter >> fillMotherIDs: aValue [ " Private - Refer to the HaploView documentation for details " @@ -190,7 +192,7 @@ BioHaploViewFormatter >> fillMotherIDs: aValue [ ] -{ #category : #populating } +{ #category : 'populating' } BioHaploViewFormatter >> fillPedigreeNames: aValue [ " Private - Refer to the HaploView documentation for details " @@ -199,7 +201,7 @@ BioHaploViewFormatter >> fillPedigreeNames: aValue [ ] -{ #category : #populating } +{ #category : 'populating' } BioHaploViewFormatter >> fillSex: aValue [ " Private - Refer to the HaploView documentation for details " @@ -207,7 +209,7 @@ BioHaploViewFormatter >> fillSex: aValue [ ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioHaploViewFormatter >> initializeWithInputFile: anInputFilename samples: aSamplesCollection affectedRows: affectedRowsCount [ self parser: (self parserClass on: anInputFilename asFileReference readStream). @@ -223,21 +225,21 @@ BioHaploViewFormatter >> initializeWithInputFile: anInputFilename samples: aSamp ] -{ #category : #accessing } +{ #category : 'accessing' } BioHaploViewFormatter >> samplesSize [ ^ samplesSize ifNil: [ samplesSize := 1 ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioHaploViewFormatter >> samplesSize: aNumber [ " Set the receiver's number of samples to aNumber " samplesSize := aNumber ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioHaploViewFormatter >> valueFor: rs [ " Private - Assign a valid null value for HaploView file format. Write two alleles for a column, answer this 'column' (String delimited by space) diff --git a/repository/BioFormatters/BioMAPFormatter.class.st b/repository/BioFormatters/BioMAPFormatter.class.st index 65de06fc..4c7eb03a 100644 --- a/repository/BioFormatters/BioMAPFormatter.class.st +++ b/repository/BioFormatters/BioMAPFormatter.class.st @@ -3,19 +3,21 @@ Reader/writer for format MAP, as described by the PLINK software. " Class { - #name : #BioMAPFormatter, - #superclass : #BioFileFormatter, - #category : #'BioFormatters-Formatters' + #name : 'BioMAPFormatter', + #superclass : 'BioFileFormatter', + #category : 'BioFormatters-Formatters', + #package : 'BioFormatters', + #tag : 'Formatters' } -{ #category : #accessing } +{ #category : 'accessing' } BioMAPFormatter class >> description [ " Private - See superimplementor's comment " ^ 'MAP Writer' ] -{ #category : #examples } +{ #category : 'examples' } BioMAPFormatter class >> exampleReadMAP1 [ ^ (self newFromInputFile: @@ -23,7 +25,7 @@ BioMAPFormatter class >> exampleReadMAP1 [ positions. ] -{ #category : #accessing } +{ #category : 'accessing' } BioMAPFormatter class >> formatExtension [ "Answer a corresponding for the receiver's file output format" @@ -31,14 +33,14 @@ BioMAPFormatter class >> formatExtension [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioMAPFormatter class >> identifiers [ "Answer a of identifiers of the receiver" ^ #('MAP') ] -{ #category : #private } +{ #category : 'private' } BioMAPFormatter >> buildMapArray [ ^ (NeoCSVReader on: (self inputFile asFileReference tailn: 5) readStream) @@ -50,14 +52,14 @@ BioMAPFormatter >> buildMapArray [ upToEnd. ] -{ #category : #accessing } +{ #category : 'accessing' } BioMAPFormatter >> positions [ " Answer a of with positions read by the receiver's file " ^ self buildMapArray ] -{ #category : #accessing } +{ #category : 'accessing' } BioMAPFormatter >> removeLinesWithChrGreaterThan: n [ " Sort records by chromosome position. Answer a new instance of the receiver. This is similar to evaluating the shell command : @@ -66,7 +68,7 @@ BioMAPFormatter >> removeLinesWithChrGreaterThan: n [ ^ self shouldBeImplemented ] -{ #category : #accessing } +{ #category : 'accessing' } BioMAPFormatter >> sortByChromosome [ " Sort records by chromosome number. Answer a new instance of the receiver. This is similar to evaluating the shell command : $ sort -t$'\t' -k 1,1n ""$inputFile"" > ""$inputFile.out" @@ -74,7 +76,7 @@ BioMAPFormatter >> sortByChromosome [ ^ self sortByField: 1. ] -{ #category : #private } +{ #category : 'private' } BioMAPFormatter >> sortByField: aNumber [ " Sort records by chromosome number. Answer a new instance of the receiver. This is similar to evaluating the shell command : $ sort -t$'\t' -k 1,1n ""$inputFile"" > ""$inputFile.out" @@ -85,7 +87,7 @@ BioMAPFormatter >> sortByField: aNumber [ ^ sortedMap ] -{ #category : #accessing } +{ #category : 'accessing' } BioMAPFormatter >> sortByPosition [ " Sort records by chromosome position. Answer a new instance of the receiver. This is similar to evaluating the shell command : $ sort -t$'\t' -k 4,4n ""$inputFile"" > ""$inputFile.out" diff --git a/repository/BioFormatters/BioMEGAFormatter.class.st b/repository/BioFormatters/BioMEGAFormatter.class.st index 4dd0a210..0f02da6e 100644 --- a/repository/BioFormatters/BioMEGAFormatter.class.st +++ b/repository/BioFormatters/BioMEGAFormatter.class.st @@ -14,8 +14,8 @@ MEGA Input Format may contain " Class { - #name : #BioMEGAFormatter, - #superclass : #BioFileFormatter, + #name : 'BioMEGAFormatter', + #superclass : 'BioFileFormatter', #instVars : [ 'alignments', 'codeTable', @@ -32,17 +32,19 @@ Class { 'propertySetting', 'title' ], - #category : #'BioFormatters-Formatters-MEGA' + #category : 'BioFormatters-Formatters-MEGA', + #package : 'BioFormatters', + #tag : 'Formatters-MEGA' } -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter class >> description [ " Answer a identifying the receiver's class " ^ 'MEGA Formatter (version 6)' ] -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioMEGAFormatter class >> forDataTypeDNA [ " Answer a new instance configured for containing nucleotide sequence data " @@ -51,7 +53,7 @@ BioMEGAFormatter class >> forDataTypeDNA [ yourself ] -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioMEGAFormatter class >> forDataTypeDistance [ " Answer a new instance configured for containing nucleotide sequence data " @@ -60,7 +62,7 @@ BioMEGAFormatter class >> forDataTypeDistance [ yourself ] -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioMEGAFormatter class >> forDataTypeNucleotide [ " Answer a new instance configured for containing nucleotide sequence data " @@ -69,7 +71,7 @@ BioMEGAFormatter class >> forDataTypeNucleotide [ yourself ] -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioMEGAFormatter class >> forDataTypeProtein [ " Answer a new instance configured for containing Protein sequence data " @@ -78,7 +80,7 @@ BioMEGAFormatter class >> forDataTypeProtein [ yourself ] -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioMEGAFormatter class >> forDataTypeRNA [ " Answer a new instance configured for containing RNA sequence data " @@ -87,34 +89,34 @@ BioMEGAFormatter class >> forDataTypeRNA [ yourself ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter class >> formatExtension [ "Answer a corresponding for the receiver's file output format" ^ 'meg' ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter class >> identifiers [ "Answer a of identifiers of the receiver" ^ #('MEGA6') ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> alignments [ " Answer a of receiver's alignment " ^ alignments ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> alignments: aCollection [ alignments := aCollection ] -{ #category : #private } +{ #category : 'private' } BioMEGAFormatter >> bestNameFor: seqAssoc [ " Answer a with a identifiable name for group of sequences in seqAssoc. See class comments for details on seqAssoc expected format " @@ -124,7 +126,7 @@ BioMEGAFormatter >> bestNameFor: seqAssoc [ ifNone: [ 'Unnamed_Seq' , BioNamedObject uniqueName ] ] -{ #category : #private } +{ #category : 'private' } BioMEGAFormatter >> buildMEGARecordId: seqName sequence: seqString [ " Answer a new MEGA record formatted for valid export to text file " @@ -134,7 +136,7 @@ BioMEGAFormatter >> buildMEGARecordId: seqName sequence: seqString [ yourself ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> codeTable [ " Answer a " @@ -144,20 +146,20 @@ BioMEGAFormatter >> codeTable [ codeTable ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> codeTable: aString [ " Set the receiver's missing to indicate missing data to be aCharacter " codeTable := aString ] -{ #category : #private } +{ #category : 'private' } BioMEGAFormatter >> defaultFormatType [ ^ 'DNA' ] -{ #category : #exporting } +{ #category : 'exporting' } BioMEGAFormatter >> export [ " Write the contents to receiver's file name " @@ -172,7 +174,7 @@ BioMEGAFormatter >> export [ contents: self stream contents. ] -{ #category : #exporting } +{ #category : 'exporting' } BioMEGAFormatter >> exportCodeTable [ " Write the receiver's code table setting " @@ -181,7 +183,7 @@ BioMEGAFormatter >> exportCodeTable [ nextPutAll: self codeTable. ] -{ #category : #exporting } +{ #category : 'exporting' } BioMEGAFormatter >> exportDataType [ self stream @@ -190,7 +192,7 @@ BioMEGAFormatter >> exportDataType [ space ] -{ #category : #exporting } +{ #category : 'exporting' } BioMEGAFormatter >> exportFromAlignment: aBioAlignment [ | records | @@ -201,7 +203,7 @@ BioMEGAFormatter >> exportFromAlignment: aBioAlignment [ whileFalse: [ self exportMegaRecords: records ] ] -{ #category : #exporting } +{ #category : 'exporting' } BioMEGAFormatter >> exportGroup: anAssociation [ " Private - Iterate over anAssociation, build and export the MegaRecords in proper format " @@ -217,7 +219,7 @@ BioMEGAFormatter >> exportGroup: anAssociation [ ^ megaRecords ] -{ #category : #exporting } +{ #category : 'exporting' } BioMEGAFormatter >> exportHeader [ " Private - The first line must contain the keyword #MEGA to indicate that the data file is in MEGA format." @@ -226,7 +228,7 @@ BioMEGAFormatter >> exportHeader [ crlf ] -{ #category : #exporting } +{ #category : 'exporting' } BioMEGAFormatter >> exportIdentical [ " Write the receiver's identical setting " @@ -235,7 +237,7 @@ BioMEGAFormatter >> exportIdentical [ nextPut: self identical ] -{ #category : #exporting } +{ #category : 'exporting' } BioMEGAFormatter >> exportIndel [ " Write the receiver's indel setting " @@ -245,7 +247,7 @@ BioMEGAFormatter >> exportIndel [ space. ] -{ #category : #exporting } +{ #category : 'exporting' } BioMEGAFormatter >> exportMegaRecords: aCollection [ " Iterate over aCollection and write results into the receiver's stream " @@ -259,7 +261,7 @@ BioMEGAFormatter >> exportMegaRecords: aCollection [ self stream cr ] -{ #category : #exporting } +{ #category : 'exporting' } BioMEGAFormatter >> exportMissing [ " Write the receiver's missing setting " @@ -269,7 +271,7 @@ BioMEGAFormatter >> exportMissing [ space ] -{ #category : #exporting } +{ #category : 'exporting' } BioMEGAFormatter >> exportNumberOfNucleotidesOrAminoacids [ " Write the receiver's number of nucleotides or amino acids " @@ -278,7 +280,7 @@ BioMEGAFormatter >> exportNumberOfNucleotidesOrAminoacids [ nextPutAll: self numberOfNucleotidesOrAminoacids asString ] -{ #category : #exporting } +{ #category : 'exporting' } BioMEGAFormatter >> exportNumberOfSequences [ " Write the receiver's number of sequences " @@ -287,7 +289,7 @@ BioMEGAFormatter >> exportNumberOfSequences [ nextPutAll: self numberOfSequences asString ] -{ #category : #exporting } +{ #category : 'exporting' } BioMEGAFormatter >> exportNumberOfSynonymsWithSequences [ " Write the receiver's number of synonyms " @@ -296,7 +298,7 @@ BioMEGAFormatter >> exportNumberOfSynonymsWithSequences [ nextPutAll: self numberOfSynonymsWithSequences asString ] -{ #category : #exporting } +{ #category : 'exporting' } BioMEGAFormatter >> exportPropertySetting [ " Write the receiver's property setting " @@ -305,7 +307,7 @@ BioMEGAFormatter >> exportPropertySetting [ nextPutAll: self propertySetting ] -{ #category : #exporting } +{ #category : 'exporting' } BioMEGAFormatter >> exportStatementDescription [ (self megaDescription includes: ';') @@ -317,7 +319,7 @@ BioMEGAFormatter >> exportStatementDescription [ crlf ] -{ #category : #exporting } +{ #category : 'exporting' } BioMEGAFormatter >> exportStatementTitle [ self stream @@ -327,21 +329,21 @@ BioMEGAFormatter >> exportStatementTitle [ crlf ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> fileNamePrefix [ " Answer a with the prefix of the output file name " ^ 'mega_' ] -{ #category : #private } +{ #category : 'private' } BioMEGAFormatter >> formatNameFrom: nameString [ " Remove invalid MEGA characters from nameString " ^ nameString copyReplaceAll: ' ' with: '_' ] -{ #category : #private } +{ #category : 'private' } BioMEGAFormatter >> formatSequenceFrom: seqString [ ^ (((seqString groupsOf: 10 atATimeCollect: [ : each | each joinUsing: String empty ]) @@ -349,20 +351,20 @@ BioMEGAFormatter >> formatSequenceFrom: seqString [ collect: [ : each | each joinUsing: String space ]) asOrderedCollection ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> formatType [ ^ formatType ifNil: [ formatType := self defaultFormatType ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> formatType: anObject [ formatType := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> groupNameQualifier [ " Answer a . The group name qualifier is a property used to group the receiver's aligned records " @@ -370,184 +372,184 @@ BioMEGAFormatter >> groupNameQualifier [ ifNil: [ groupNameQualifier := 'breed' ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> groupNameQualifier: anObject [ ^ groupNameQualifier := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> identical [ ^ identical ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> identical: aCharacter [ " Set the receiver's identical to show identify with the first sequence to be aCharacter " identical := aCharacter ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> indel [ ^ indel ifNil: [ indel := $- ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> indel: aCharacter [ " Set the receiver's indel to identify insertion/deletions in sequence alignments to be aCharacter " indel := aCharacter ] -{ #category : #testing } +{ #category : 'testing' } BioMEGAFormatter >> isAlignmentEmpty: aCollection [ ^ aCollection allSatisfy: [ : megaRecordGroup | megaRecordGroup allSatisfy: [ : mr | mr hasEmptyAlignment ] ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> megaDescription [ ^ megaDescription ifNil: [ megaDescription := 'Missing Description' ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> megaDescription: anObject [ megaDescription := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> missing [ ^ missing ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> missing: aCharacter [ " Set the receiver's missing to indicate missing data to be aCharacter " missing := aCharacter ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> numberOfNucleotidesOrAminoacids [ ^ numberOfNucleotidesOrAminoacids ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> numberOfNucleotidesOrAminoacids: aNumber [ " Set the receiver's number of nucleotides or amino acids to be aNumber " numberOfNucleotidesOrAminoacids := aNumber ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> numberOfSequences [ ^ numberOfSequences ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> numberOfSequences: aNumber [ " Set the receiver's number of sequences to be aNumber " numberOfSequences := aNumber ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> numberOfSynonymsWithSequences [ ^ numberOfSynonymsWithSequences ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> numberOfSynonymsWithSequences: aNumber [ " Set the receiver's number of synonyms to be aNumber " numberOfSynonymsWithSequences := aNumber ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> propertySetting [ ^ propertySetting ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> propertySetting: aString [ " Set the receiver's property setting to be aString " propertySetting := aString ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> setCodeTableAsStandard [ self codeTable: 'Standard' ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> setDataFormatAsLowerleft [ " Set the DataFormat property " self dataFormat: 'Lowerleft' ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> setDataFormatAsUpperright [ " Set the DataFormat property " self dataFormat: 'Uperright' ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> setPropertyAsCoding [ " Set the receiver's property " self propertySetting: 'Coding' ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> setPropertyAsEnd [ " Set the receiver's property " self propertySetting: 'End' ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> setPropertyAsExon [ " Set the receiver's property " self propertySetting: 'Exon' ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> setPropertyAsIntron [ " Set the receiver's property " self propertySetting: 'Intron' ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> setPropertyAsNonCoding [ " Set the receiver's property " self propertySetting: 'NonCoding' ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> title [ ^ title ifNil: [ title := 'Missing Title' ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGAFormatter >> title: anObject [ title := anObject ] diff --git a/repository/BioFormatters/BioMEGASeqRecord.class.st b/repository/BioFormatters/BioMEGASeqRecord.class.st index 78e0bf8e..8e9d2445 100644 --- a/repository/BioFormatters/BioMEGASeqRecord.class.st +++ b/repository/BioFormatters/BioMEGASeqRecord.class.st @@ -5,25 +5,27 @@ Instance Variables alignment: " Class { - #name : #BioMEGASeqRecord, - #superclass : #BioSeqRecord, + #name : 'BioMEGASeqRecord', + #superclass : 'BioSeqRecord', #instVars : [ 'alignment' ], - #category : 'BioFormatters-Formatters-MEGA' + #category : 'BioFormatters-Formatters-MEGA', + #package : 'BioFormatters', + #tag : 'Formatters-MEGA' } -{ #category : #accessing } +{ #category : 'accessing' } BioMEGASeqRecord >> alignment [ ^ alignment ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGASeqRecord >> alignment: anObject [ alignment := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGASeqRecord >> exportTo: aWriteStream nameSpacing: anInteger alignmentNumber: alnNumber [ " Private - Write the receiver's name and first alignment line then pop it from the alignment " @@ -37,19 +39,19 @@ BioMEGASeqRecord >> exportTo: aWriteStream nameSpacing: anInteger alignmentNumb aWriteStream nextPutAll: self popAlignment. ] -{ #category : #testing } +{ #category : 'testing' } BioMEGASeqRecord >> hasEmptyAlignment [ ^ self alignment isEmpty ] -{ #category : #accessing } +{ #category : 'accessing' } BioMEGASeqRecord >> popAlignment [ ^ self alignment removeFirst. ] -{ #category : #printing } +{ #category : 'printing' } BioMEGASeqRecord >> printOn: aStream [ " Private - See superimplementor's comment " diff --git a/repository/BioFormatters/BioMatrixFormatter.class.st b/repository/BioFormatters/BioMatrixFormatter.class.st index 8a73d07d..98382092 100644 --- a/repository/BioFormatters/BioMatrixFormatter.class.st +++ b/repository/BioFormatters/BioMatrixFormatter.class.st @@ -16,23 +16,25 @@ Instance Variables: " Class { - #name : #BioMatrixFormatter, - #superclass : #BioFileFormatter, + #name : 'BioMatrixFormatter', + #superclass : 'BioFileFormatter', #instVars : [ 'matrix', 'delimiter' ], - #category : #'BioFormatters-Formatters' + #category : 'BioFormatters-Formatters', + #package : 'BioFormatters', + #tag : 'Formatters' } -{ #category : #accessing } +{ #category : 'accessing' } BioMatrixFormatter class >> description [ " See superimplementor's comment " ^ 'Generic Matrix Formatter/Writer' ] -{ #category : #accessing } +{ #category : 'accessing' } BioMatrixFormatter class >> formatExtension [ "Answer a corresponding for the receiver's file output format" @@ -40,13 +42,13 @@ BioMatrixFormatter class >> formatExtension [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioMatrixFormatter >> atColumn: aNumber [ ^ self matrix atColumn: aNumber ] -{ #category : #populating } +{ #category : 'populating' } BioMatrixFormatter >> atColumn: aNumber fillWith: aValue [ aValue @@ -55,7 +57,7 @@ BioMatrixFormatter >> atColumn: aNumber fillWith: aValue [ ] -{ #category : #populating } +{ #category : 'populating' } BioMatrixFormatter >> atColumn: colNumber fillWith: aValue repeat: repNumber [ " Repeat repNumber times, aValue in column colNumber Example: self atColumn: 1 fillWith: 'BM1818' repeat: 3 @@ -73,7 +75,7 @@ BioMatrixFormatter >> atColumn: colNumber fillWith: aValue repeat: repNumber [ ] -{ #category : #populating } +{ #category : 'populating' } BioMatrixFormatter >> atColumn: aColumnNumber fillWith: aValue startingAt: rowNumber [ " Fill the receiver's matrix with aValue at aColumnNumber beggining at rowNumber. rowNumber must be >= 1 " @@ -84,7 +86,7 @@ BioMatrixFormatter >> atColumn: aColumnNumber fillWith: aValue startingAt: rowNu ] -{ #category : #populating } +{ #category : 'populating' } BioMatrixFormatter >> atRow: aNumber fillWith: aValue [ aValue @@ -93,7 +95,7 @@ BioMatrixFormatter >> atRow: aNumber fillWith: aValue [ ] -{ #category : #populating } +{ #category : 'populating' } BioMatrixFormatter >> atRow: rowNumber fillWith: aValue startingAt: columnNumber [ " Fill the receiver's matrix with aValue at rowNumber beggining at columnNumber. columnNumber must be >= 1 " @@ -105,7 +107,7 @@ BioMatrixFormatter >> atRow: rowNumber fillWith: aValue startingAt: columnNumber ] -{ #category : #accessing } +{ #category : 'accessing' } BioMatrixFormatter >> delimiter [ " Answer a used to delimit fields. Do not use lazy initialization " @@ -113,21 +115,21 @@ BioMatrixFormatter >> delimiter [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioMatrixFormatter >> delimiter: aCharacter [ " Set aCharacter as delimiter for the receiver's fields " delimiter := aCharacter ] -{ #category : #accessing } +{ #category : 'accessing' } BioMatrixFormatter >> do: aBlock [ " Iterate through the receiver's elements " ^ self matrix rowsDo: aBlock ] -{ #category : #exporting } +{ #category : 'exporting' } BioMatrixFormatter >> exportCellAtRow: rowIndex atColumn: colIndex [ " Private - Assume matrix contents at rowIndex and colIndex are not nil. " @@ -135,7 +137,7 @@ BioMatrixFormatter >> exportCellAtRow: rowIndex atColumn: colIndex [ self exportCellDelimiter. ] -{ #category : #exporting } +{ #category : 'exporting' } BioMatrixFormatter >> exportCellAtRow: rowIndex atColumn: colIndex matrix: theMatrix [ " Private - Assume matrix contents at rowIndex and colIndex are not nil. " @@ -143,19 +145,19 @@ BioMatrixFormatter >> exportCellAtRow: rowIndex atColumn: colIndex matrix: theMa self exportCellDelimiter. ] -{ #category : #exporting } +{ #category : 'exporting' } BioMatrixFormatter >> exportCellDelimiter [ " Private - Write cell separator " self outputFileStream nextPut: Character space. ] -{ #category : #exporting } +{ #category : 'exporting' } BioMatrixFormatter >> exportFirstCellColumnAt: rowIndex [ " Write contents for the first column(s) at rowIndex position " ] -{ #category : #exporting } +{ #category : 'exporting' } BioMatrixFormatter >> exportMatrix [ " Write the receiver's matrix to a file " @@ -164,7 +166,7 @@ BioMatrixFormatter >> exportMatrix [ self bioLog: 'Finished writing matrix to file'. ] -{ #category : #exporting } +{ #category : 'exporting' } BioMatrixFormatter >> exportMatrix: theMatrix [ 1 to: theMatrix numberOfRows do: [: rowIndex | @@ -175,35 +177,35 @@ BioMatrixFormatter >> exportMatrix: theMatrix [ self outputFileStream close. ] -{ #category : #exporting } +{ #category : 'exporting' } BioMatrixFormatter >> fileNamePrefix [ " Answer a String for prefixing the output file name " ^ 'BioST-Exported-Matrix_' ] -{ #category : #accessing } +{ #category : 'accessing' } BioMatrixFormatter >> initMatrixRows: rowsNumber columns: columnsNumber [ " Private - Initialize the receiver's matrix with rowsNumber and columnsNumber " matrix := self matrixClass rows: rowsNumber columns: columnsNumber. ] -{ #category : #accessing } +{ #category : 'accessing' } BioMatrixFormatter >> matrix [ " Answer the receiver's matrix " ^ matrix ] -{ #category : #accessing } +{ #category : 'accessing' } BioMatrixFormatter >> matrix: anObject [ " Set the receiver's internal matrix " matrix := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioMatrixFormatter >> matrixClass [ " Answer a used for matrices in the receiver " @@ -211,7 +213,7 @@ BioMatrixFormatter >> matrixClass [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioMatrixFormatter >> size [ " Answer how many elements has the receiver's matrix " diff --git a/repository/BioFormatters/BioNaming.class.st b/repository/BioFormatters/BioNaming.class.st index 577c480d..42b1f06c 100644 --- a/repository/BioFormatters/BioNaming.class.st +++ b/repository/BioFormatters/BioNaming.class.st @@ -2,19 +2,21 @@ Strategy to format names accordingly to specific conditions. The #format: method must be implemented in subclasses " Class { - #name : #BioNaming, - #superclass : #BioObject, - #category : 'BioFormatters-Naming' + #name : 'BioNaming', + #superclass : 'BioObject', + #category : 'BioFormatters-Naming', + #package : 'BioFormatters', + #tag : 'Naming' } -{ #category : #accessing } +{ #category : 'accessing' } BioNaming >> format: aString [ " Answer a String from contracting first letters from aString " self subclassResponsibility ] -{ #category : #testing } +{ #category : 'testing' } BioNaming >> isNamingFormat [ ^ true diff --git a/repository/BioFormatters/BioNewickFormatter.class.st b/repository/BioFormatters/BioNewickFormatter.class.st index 6674d37d..57b4c5e5 100644 --- a/repository/BioFormatters/BioNewickFormatter.class.st +++ b/repository/BioFormatters/BioNewickFormatter.class.st @@ -2,7 +2,9 @@ Newick Standard phylogenetic tree formatter " Class { - #name : #BioNewickFormatter, - #superclass : #BioFileFormatter, - #category : 'BioFormatters-Formatters' + #name : 'BioNewickFormatter', + #superclass : 'BioFileFormatter', + #category : 'BioFormatters-Formatters', + #package : 'BioFormatters', + #tag : 'Formatters' } diff --git a/repository/BioFormatters/BioNexusBlock.class.st b/repository/BioFormatters/BioNexusBlock.class.st index d385539f..3276d560 100644 --- a/repository/BioFormatters/BioNexusBlock.class.st +++ b/repository/BioFormatters/BioNexusBlock.class.st @@ -3,7 +3,9 @@ Abstract class for several types of Nexus blocks. " Class { - #name : #BioNexusBlock, - #superclass : #BioNamedObject, - #category : 'BioFormatters-Formatters-NEXUS' + #name : 'BioNexusBlock', + #superclass : 'BioNamedObject', + #category : 'BioFormatters-Formatters-NEXUS', + #package : 'BioFormatters', + #tag : 'Formatters-NEXUS' } diff --git a/repository/BioFormatters/BioPEDFormatter.class.st b/repository/BioFormatters/BioPEDFormatter.class.st index 201475d2..fc87a1cc 100644 --- a/repository/BioFormatters/BioPEDFormatter.class.st +++ b/repository/BioFormatters/BioPEDFormatter.class.st @@ -2,19 +2,21 @@ http://pngu.mgh.harvard.edu/~purcell/plink/data.shtml#ped " Class { - #name : #BioPEDFormatter, - #superclass : #BioFileFormatter, - #category : #'BioFormatters-Formatters' + #name : 'BioPEDFormatter', + #superclass : 'BioFileFormatter', + #category : 'BioFormatters-Formatters', + #package : 'BioFormatters', + #tag : 'Formatters' } -{ #category : #accessing } +{ #category : 'accessing' } BioPEDFormatter class >> description [ " Private - See superimplementor's comment " ^ 'PED Writer' ] -{ #category : #accessing } +{ #category : 'accessing' } BioPEDFormatter class >> formatExtension [ "Answer a corresponding for the receiver's file output format" @@ -22,7 +24,7 @@ BioPEDFormatter class >> formatExtension [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioPEDFormatter class >> identifiers [ "Answer a of identifiers of the receiver" diff --git a/repository/BioFormatters/BioPHASECSVFormatter.class.st b/repository/BioFormatters/BioPHASECSVFormatter.class.st index 93f0f47a..d2ed1177 100644 --- a/repository/BioFormatters/BioPHASECSVFormatter.class.st +++ b/repository/BioFormatters/BioPHASECSVFormatter.class.st @@ -1,17 +1,19 @@ Class { - #name : #BioPHASECSVFormatter, - #superclass : #BioCSVFormatter, - #category : #'BioFormatters-Formatters-PHASE' + #name : 'BioPHASECSVFormatter', + #superclass : 'BioCSVFormatter', + #category : 'BioFormatters-Formatters-PHASE', + #package : 'BioFormatters', + #tag : 'Formatters-PHASE' } -{ #category : #accessing } +{ #category : 'accessing' } BioPHASECSVFormatter class >> description [ " See superimplementor's comment " ^ 'INP (CSV) from PHASE Software' ] -{ #category : #examples } +{ #category : 'examples' } BioPHASECSVFormatter class >> example1 [ | inpFile | @@ -22,14 +24,14 @@ BioPHASECSVFormatter class >> example1 [ self new readFrom: inpFile. ] -{ #category : #accessing } +{ #category : 'accessing' } BioPHASECSVFormatter class >> identifiers [ "Answer a of identifiers of the receiver" ^ #('INP') ] -{ #category : #initialize } +{ #category : 'initialize' } BioPHASECSVFormatter >> initialize [ " Private - See superimplementor's comment " @@ -37,7 +39,7 @@ BioPHASECSVFormatter >> initialize [ self delimiterSourceCharacter: BioPhaseINPFile delimiter. ] -{ #category : #accessing } +{ #category : 'accessing' } BioPHASECSVFormatter >> isIDCCRow: row [ " Answer if row is used for identifying individuals and/or case/control status " @@ -45,13 +47,13 @@ BioPHASECSVFormatter >> isIDCCRow: row [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioPHASECSVFormatter >> processGenotype: row [ self subclassResponsibility ] -{ #category : #accessing } +{ #category : 'accessing' } BioPHASECSVFormatter >> readFrom: aFile [ " Answer a of genotype objects " diff --git a/repository/BioFormatters/BioPhaseINPFile.class.st b/repository/BioFormatters/BioPhaseINPFile.class.st index 93660a9c..d0658a4b 100644 --- a/repository/BioFormatters/BioPhaseINPFile.class.st +++ b/repository/BioFormatters/BioPhaseINPFile.class.st @@ -2,22 +2,24 @@ This is the INP file format as described by PHASE software : " Class { - #name : #BioPhaseINPFile, - #superclass : #BioFile, + #name : 'BioPhaseINPFile', + #superclass : 'BioFile', #instVars : [ 'headerLinesCount' ], - #category : 'BioFormatters-Formatters-PHASE' + #category : 'BioFormatters-Formatters-PHASE', + #package : 'BioFormatters', + #tag : 'Formatters-PHASE' } -{ #category : #accessing } +{ #category : 'accessing' } BioPhaseINPFile class >> delimiter [ " Answer the used to delimit fields " ^ Character space ] -{ #category : #examples } +{ #category : 'examples' } BioPhaseINPFile class >> example01 [ | inpFile | @@ -27,28 +29,28 @@ BioPhaseINPFile class >> example01 [ yourself. ] -{ #category : #accessing } +{ #category : 'accessing' } BioPhaseINPFile class >> possibleExtensions [ " See superimplementor's comment" ^ self fileFormatterClass fileExtensionsFor: 'INP' ] -{ #category : #examples } +{ #category : 'examples' } BioPhaseINPFile class >> testFilesFullDirectoryName [ " See superimplementor's comment " ^ super testFilesFullDirectoryName / 'phase' ] -{ #category : #accessing } +{ #category : 'accessing' } BioPhaseINPFile >> headerLinesCount [ " Answer a representing the count of header lines in the receiver " ^ headerLinesCount ] -{ #category : #accessing } +{ #category : 'accessing' } BioPhaseINPFile >> headerLinesCount: anObject [ headerLinesCount := anObject ] diff --git a/repository/BioFormatters/BioPhaseMAPFile.class.st b/repository/BioFormatters/BioPhaseMAPFile.class.st index e638c060..bbe6c289 100644 --- a/repository/BioFormatters/BioPhaseMAPFile.class.st +++ b/repository/BioFormatters/BioPhaseMAPFile.class.st @@ -3,12 +3,14 @@ This is the INP file format as described by PHASE software : " Class { - #name : #BioPhaseMAPFile, - #superclass : #BioFile, - #category : 'BioFormatters-Formatters-PHASE' + #name : 'BioPhaseMAPFile', + #superclass : 'BioFile', + #category : 'BioFormatters-Formatters-PHASE', + #package : 'BioFormatters', + #tag : 'Formatters-PHASE' } -{ #category : #accessing } +{ #category : 'accessing' } BioPhaseMAPFile class >> possibleExtensions [ " See superimplementor's comment" diff --git a/repository/BioFormatters/BioPhylip.class.st b/repository/BioFormatters/BioPhylip.class.st index be001e20..b6390d50 100644 --- a/repository/BioFormatters/BioPhylip.class.st +++ b/repository/BioFormatters/BioPhylip.class.st @@ -30,17 +30,19 @@ Internal Representation and Key Implementation Points. Implementation Points " Class { - #name : #BioPhylip, - #superclass : #BioNamedObject, + #name : 'BioPhylip', + #superclass : 'BioNamedObject', #instVars : [ 'numberOfTaxa', 'numberOfCharacters', 'sequences' ], - #category : #'BioFormatters-Formatters-PHYLIP' + #category : 'BioFormatters-Formatters-PHYLIP', + #package : 'BioFormatters', + #tag : 'Formatters-PHYLIP' } -{ #category : #accessing } +{ #category : 'accessing' } BioPhylip >> asAlignment [ " Answer a object with receiver's contents " @@ -51,7 +53,7 @@ BioPhylip >> asAlignment [ ^ align ] -{ #category : #converting } +{ #category : 'converting' } BioPhylip >> asString [ " Answer the String representation of the receiver." @@ -69,41 +71,41 @@ BioPhylip >> asString [ stream nextPutAll: seq ] ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioPhylip >> numberOfBases [ " Answer an with the receiver number of characters in the matrix " ^ numberOfCharacters ] -{ #category : #accessing } +{ #category : 'accessing' } BioPhylip >> numberOfCharacters: anObject [ numberOfCharacters := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioPhylip >> numberOfTaxa [ " Answer an with the receiver number of taxa " ^ numberOfTaxa ] -{ #category : #accessing } +{ #category : 'accessing' } BioPhylip >> numberOfTaxa: anObject [ numberOfTaxa := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioPhylip >> sequences [ ^ sequences ] -{ #category : #accessing } +{ #category : 'accessing' } BioPhylip >> sequences: anObject [ sequences := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioPhylip >> taxonIdentifiers [ " Answer a with the taxon identifiers in the receiver (up to 10 characters each) " diff --git a/repository/BioFormatters/BioPhylipFile.class.st b/repository/BioFormatters/BioPhylipFile.class.st index c0c7fe2d..2fe31447 100644 --- a/repository/BioFormatters/BioPhylipFile.class.st +++ b/repository/BioFormatters/BioPhylipFile.class.st @@ -3,43 +3,45 @@ A BioPhylipFile is a representation of a PHYLIP sequence format in a file system " Class { - #name : #BioPhylipFile, - #superclass : #BioFile, + #name : 'BioPhylipFile', + #superclass : 'BioFile', #instVars : [ 'interleaved' ], - #category : 'BioFormatters-Formatters-PHYLIP' + #category : 'BioFormatters-Formatters-PHYLIP', + #package : 'BioFormatters', + #tag : 'Formatters-PHYLIP' } -{ #category : #accessing } +{ #category : 'accessing' } BioPhylipFile class >> possibleExtensions [ " See superimplementor's comment" ^ self fileFormatterClass fileExtensionsFor: 'Phylip' ] -{ #category : #accessing } +{ #category : 'accessing' } BioPhylipFile >> beInterleaved [ " Set the receiver to be in interleaved format " interleaved := true ] -{ #category : #accessing } +{ #category : 'accessing' } BioPhylipFile >> beSequential [ " Set the receiver to be in interleaved format " interleaved := false ] -{ #category : #testing } +{ #category : 'testing' } BioPhylipFile >> isInterleaved [ " Answer if the receiver is in interleaved format " ^ interleaved ] -{ #category : #testing } +{ #category : 'testing' } BioPhylipFile >> isSequential [ " Answer if the receiver is in sequential format " diff --git a/repository/BioFormatters/BioRDFLegacyFormatter.class.st b/repository/BioFormatters/BioRDFLegacyFormatter.class.st index a71d54a5..e928b297 100644 --- a/repository/BioFormatters/BioRDFLegacyFormatter.class.st +++ b/repository/BioFormatters/BioRDFLegacyFormatter.class.st @@ -23,31 +23,33 @@ Nuu6b TTCACTCTGTTCCCGCCCTATTCTCA 1 " Class { - #name : #BioRDFLegacyFormatter, - #superclass : #BioMatrixFormatter, + #name : 'BioRDFLegacyFormatter', + #superclass : 'BioMatrixFormatter', #instVars : [ 'frequencies', 'positionCiphers', 'nameIndex' ], - #category : #'BioFormatters-Formatters' + #category : 'BioFormatters-Formatters', + #package : 'BioFormatters', + #tag : 'Formatters' } -{ #category : #accessing } +{ #category : 'accessing' } BioRDFLegacyFormatter class >> description [ " Answer a Collection of identifiers of the receiver " ^ 'Fluxus Network Legacy RDF Format' ] -{ #category : #accessing } +{ #category : 'accessing' } BioRDFLegacyFormatter class >> identifiers [ "Answer a of identifiers of the receiver" ^ #('Obsolete Fluxus' 'Obsolete Network') ] -{ #category : #exporting } +{ #category : 'exporting' } BioRDFLegacyFormatter >> exportCellAtRow: rIndex atColumn: cIndex [ | contents | @@ -56,7 +58,7 @@ BioRDFLegacyFormatter >> exportCellAtRow: rIndex atColumn: cIndex [ self outputFileStream nextPutAll: contents asString. ] -{ #category : #exporting } +{ #category : 'exporting' } BioRDFLegacyFormatter >> exportFirstCellColumnAt: rowIndex [ " Write contents for the first column(s) at rowIndex position " @@ -75,7 +77,7 @@ BioRDFLegacyFormatter >> exportFirstCellColumnAt: rowIndex [ space ]. ] -{ #category : #exporting } +{ #category : 'exporting' } BioRDFLegacyFormatter >> exportFromBLAST: hitCollection [ " Write two files: 1) A time-stamped file in the receiver's format from hitCollecction @@ -97,7 +99,7 @@ BioRDFLegacyFormatter >> exportFromBLAST: hitCollection [ self exportIdentifiers: hitCollection. ] -{ #category : #exporting } +{ #category : 'exporting' } BioRDFLegacyFormatter >> exportIdentifiers: hitCollection [ | tmpFile | @@ -113,7 +115,7 @@ BioRDFLegacyFormatter >> exportIdentifiers: hitCollection [ tmpFile close. ] -{ #category : #exporting } +{ #category : 'exporting' } BioRDFLegacyFormatter >> exportWeights [ " Private - Write the weight row " @@ -125,14 +127,14 @@ BioRDFLegacyFormatter >> exportWeights [ ] -{ #category : #exporting } +{ #category : 'exporting' } BioRDFLegacyFormatter >> fileNamePrefix [ " Answer a String for prefixing the output file name " ^ 'BioST-Exported-fluxus-old-rdf_' ] -{ #category : #populating } +{ #category : 'populating' } BioRDFLegacyFormatter >> fillDataColumnsFrom: hitCollection [ | columns alignLength | @@ -157,7 +159,7 @@ BioRDFLegacyFormatter >> fillDataColumnsFrom: hitCollection [ ] -{ #category : #populating } +{ #category : 'populating' } BioRDFLegacyFormatter >> fillFrequenciesColumn [ " Fill the receiver's matrix with the frequencies at last column. If frequencies were not provided, then fill the frequencies column with 1's " @@ -169,7 +171,7 @@ BioRDFLegacyFormatter >> fillFrequenciesColumn [ ] -{ #category : #populating } +{ #category : 'populating' } BioRDFLegacyFormatter >> fillHeaderColumns: columns [ " Private - columns is a Collection where differences were found " @@ -184,7 +186,7 @@ BioRDFLegacyFormatter >> fillHeaderColumns: columns [ ] ] -{ #category : #populating } +{ #category : 'populating' } BioRDFLegacyFormatter >> fillMatrixFrom: hitCollection columns: columns [ columns doWithIndex: [: colIndex : cIndex | @@ -200,7 +202,7 @@ BioRDFLegacyFormatter >> fillMatrixFrom: hitCollection columns: columns [ ] -{ #category : #populating } +{ #category : 'populating' } BioRDFLegacyFormatter >> fillPosition: colIndex for: maxDigits [ " Private - Build a column position, answer a String 001 005 032 145 ... " @@ -215,7 +217,7 @@ BioRDFLegacyFormatter >> fillPosition: colIndex for: maxDigits [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioRDFLegacyFormatter >> formatExtension [ "Answer a corresponding for the receiver's file output format" @@ -223,7 +225,7 @@ BioRDFLegacyFormatter >> formatExtension [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioRDFLegacyFormatter >> frequencies [ " Answer a Collection with the receiver's frequencies " @@ -237,7 +239,7 @@ BioRDFLegacyFormatter >> frequencies [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioRDFLegacyFormatter >> nameCharacterLimit [ " Answer a Number representing the max number of characters allowed to represent names " @@ -245,7 +247,7 @@ BioRDFLegacyFormatter >> nameCharacterLimit [ ^ 6 ] -{ #category : #accessing } +{ #category : 'accessing' } BioRDFLegacyFormatter >> nameIndex [ " Answer a Number representing the current processed name " @@ -254,21 +256,21 @@ BioRDFLegacyFormatter >> nameIndex [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioRDFLegacyFormatter >> nameIndex: aNumber [ " Set the number representing the current processed name to aNumber " ^ nameIndex := aNumber ] -{ #category : #accessing } +{ #category : 'accessing' } BioRDFLegacyFormatter >> positionCiphers [ " Answer a Number of the digits for making space in the vertical positions header " ^ positionCiphers ] -{ #category : #exporting } +{ #category : 'exporting' } BioRDFLegacyFormatter >> rowIdentifier [ " Answer a String " | eName | diff --git a/repository/BioFormatters/BioRehhLogPValueCollector.class.st b/repository/BioFormatters/BioRehhLogPValueCollector.class.st index cb0dc458..cde0b68d 100644 --- a/repository/BioFormatters/BioRehhLogPValueCollector.class.st +++ b/repository/BioFormatters/BioRehhLogPValueCollector.class.st @@ -8,8 +8,8 @@ Can dump to UCSC bed file format, to input in the Genome Browser ""add custom tr Implementation Points " Class { - #name : #BioRehhLogPValueCollector, - #superclass : #BioFileFormatter, + #name : 'BioRehhLogPValueCollector', + #superclass : 'BioFileFormatter', #instVars : [ 'logpCol', 'gpeaks', @@ -18,10 +18,12 @@ Class { 'bedFormatter', 'chrNumber' ], - #category : 'BioFormatters-Formatters' + #category : 'BioFormatters-Formatters', + #package : 'BioFormatters', + #tag : 'Formatters' } -{ #category : #examples } +{ #category : 'examples' } BioRehhLogPValueCollector class >> example01 [ 26 to: 29 do: [ :chrNumber | @@ -41,7 +43,7 @@ BioRehhLogPValueCollector class >> example01 [ dumpAsUCSCBedFile ] ] -{ #category : #examples } +{ #category : 'examples' } BioRehhLogPValueCollector class >> example02 [ 26 to: 29 do: [ :chrNumber | @@ -61,7 +63,7 @@ BioRehhLogPValueCollector class >> example02 [ dumpAsEnsembleBedFile ] ] -{ #category : #examples } +{ #category : 'examples' } BioRehhLogPValueCollector class >> example03 [ 26 to: 29 do: [ :chrNumber | @@ -81,28 +83,28 @@ BioRehhLogPValueCollector class >> example03 [ dumpAsEnsembleBedFileBothStrands ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioRehhLogPValueCollector >> bedFormatter [ ^ bedFormatter ifNil: [ bedFormatter := BioBEDFormatter new ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioRehhLogPValueCollector >> bedFormatter: anObject [ bedFormatter := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioRehhLogPValueCollector >> chrNumber [ ^ chrNumber ] -{ #category : #accessing } +{ #category : 'accessing' } BioRehhLogPValueCollector >> chrNumber: anObject [ chrNumber := anObject ] -{ #category : #private } +{ #category : 'private' } BioRehhLogPValueCollector >> collectLogPPeaks [ | index lpstart | @@ -123,7 +125,7 @@ BioRehhLogPValueCollector >> collectLogPPeaks [ index := index + 1 ]. ] -{ #category : #private } +{ #category : 'private' } BioRehhLogPValueCollector >> collectLogPValues [ " For each SNP in the input file, build a with valid (not null) -log10(p-value) which are greater than configured ylim value " @@ -134,7 +136,7 @@ BioRehhLogPValueCollector >> collectLogPValues [ select: [ : record | record fourth notNil and: [ record fourth ~= 'NA' and: [ record fourth asFloat >= self ylim ] ] ] ]). ] -{ #category : #private } +{ #category : 'private' } BioRehhLogPValueCollector >> collectPeaks [ " See class comments " @@ -143,7 +145,7 @@ BioRehhLogPValueCollector >> collectPeaks [ collectLogPPeaks ] -{ #category : #private } +{ #category : 'private' } BioRehhLogPValueCollector >> dumpAsEnsembleBedFile [ | chrStr | @@ -158,7 +160,7 @@ BioRehhLogPValueCollector >> dumpAsEnsembleBedFile [ self dumpUCSCBedPeaks: chrStr ] -{ #category : #private } +{ #category : 'private' } BioRehhLogPValueCollector >> dumpAsEnsembleBedFileBothStrands [ | chrStr index | @@ -189,7 +191,7 @@ BioRehhLogPValueCollector >> dumpAsEnsembleBedFileBothStrands [ self bedFormatter flush. ] -{ #category : #private } +{ #category : 'private' } BioRehhLogPValueCollector >> dumpAsUCSCBedFile [ | chrStr | @@ -204,7 +206,7 @@ BioRehhLogPValueCollector >> dumpAsUCSCBedFile [ self dumpUCSCBedPeaks: chrStr ] -{ #category : #private } +{ #category : 'private' } BioRehhLogPValueCollector >> dumpUCSCBedPeaks: chrStr [ | index | @@ -220,42 +222,42 @@ BioRehhLogPValueCollector >> dumpUCSCBedPeaks: chrStr [ self bedFormatter flush. ] -{ #category : #accessing } +{ #category : 'accessing' } BioRehhLogPValueCollector >> gpeaks [ ^ gpeaks ] -{ #category : #accessing } +{ #category : 'accessing' } BioRehhLogPValueCollector >> gpeaks: anObject [ gpeaks := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioRehhLogPValueCollector >> logpCol [ ^ logpCol ] -{ #category : #accessing } +{ #category : 'accessing' } BioRehhLogPValueCollector >> logpCol: anObject [ logpCol := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioRehhLogPValueCollector >> nbases [ ^ nbases ] -{ #category : #accessing } +{ #category : 'accessing' } BioRehhLogPValueCollector >> nbases: anObject [ nbases := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioRehhLogPValueCollector >> ylim [ ^ ylim ] -{ #category : #accessing } +{ #category : 'accessing' } BioRehhLogPValueCollector >> ylim: anObject [ ylim := anObject ] diff --git a/repository/BioFormatters/BioRestrictionMapFormatter.class.st b/repository/BioFormatters/BioRestrictionMapFormatter.class.st new file mode 100644 index 00000000..c3e61e8c --- /dev/null +++ b/repository/BioFormatters/BioRestrictionMapFormatter.class.st @@ -0,0 +1,54 @@ +Class { + #name : 'BioRestrictionMapFormatter', + #superclass : 'BioSequenceFormatter', + #category : 'BioFormatters-Formatters-Restriction', + #package : 'BioFormatters', + #tag : 'Formatters-Restriction' +} + +{ #category : 'formatting' } +BioRestrictionMapFormatter >> format: aSequence enzymes: aCollection [ + + | stream sites | + stream := WriteStream on: String new. + stream + nextPutAll: 'Restriction Map for: '; + nextPutAll: aSequence name asString; + cr. + stream + nextPutAll: 'Length: '; + nextPutAll: aSequence size asString; + cr. + stream + nextPutAll: 'Topology: '; + nextPutAll: (aSequence isCircular + ifTrue: [ 'Circular' ] + ifFalse: [ 'Linear' ]); + cr. + stream cr. + + sites := OrderedCollection new. + aCollection do: [ :enzyme | + sites addAll: ((enzyme searchIn: aSequence) collect: [ :pos | + { + pos. + enzyme name. + (pos + enzyme cut5) } ]) ]. + + sites sort: [ :a :b | a first < b first ]. + + stream + nextPutAll: 'Site Index' , Character tab asString , 'Enzyme' + , Character tab asString , 'Cut Position'; + cr. + sites do: [ :each | + stream + nextPutAll: each first asString; + tab; + nextPutAll: each second asString; + tab; + nextPutAll: each third asString; + cr ]. + + ^ stream contents +] diff --git a/repository/BioFormatters/BioSequenceFeature.extension.st b/repository/BioFormatters/BioSequenceFeature.extension.st index 7136b43e..c67fc8e9 100644 --- a/repository/BioFormatters/BioSequenceFeature.extension.st +++ b/repository/BioFormatters/BioSequenceFeature.extension.st @@ -1,13 +1,13 @@ -Extension { #name : #BioSequenceFeature } +Extension { #name : 'BioSequenceFeature' } -{ #category : #'*BioFormatters' } +{ #category : '*BioFormatters' } BioSequenceFeature >> asBedString [ "Answer a formatting the receiver according to a BED line format" ^ (BioFormatter formatterForExact: 'bed') fromSequenceFeature: self ] -{ #category : #'*BioFormatters' } +{ #category : '*BioFormatters' } BioSequenceFeature >> asGFF3 [ " Answer a with the receiver's printed as a Generic Feature Format version 3 line " diff --git a/repository/BioFormatters/BioSequenceFeatureFormatter.class.st b/repository/BioFormatters/BioSequenceFeatureFormatter.class.st index 0702129d..b6391d86 100644 --- a/repository/BioFormatters/BioSequenceFeatureFormatter.class.st +++ b/repository/BioFormatters/BioSequenceFeatureFormatter.class.st @@ -1,13 +1,15 @@ Class { - #name : #BioSequenceFeatureFormatter, - #superclass : #BioFileFormatter, + #name : 'BioSequenceFeatureFormatter', + #superclass : 'BioFileFormatter', #instVars : [ 'sequenceFeature' ], - #category : #'BioFormatters-Formatters' + #category : 'BioFormatters-Formatters', + #package : 'BioFormatters', + #tag : 'Formatters' } -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioSequenceFeatureFormatter class >> fromSequenceFeature: aBioSequenceFeature [ " Answer a new instance of the receiver using information from aBioSequenceFeature " @@ -16,12 +18,12 @@ BioSequenceFeatureFormatter class >> fromSequenceFeature: aBioSequenceFeature [ yourself ] -{ #category : #accessing } +{ #category : 'accessing' } BioSequenceFeatureFormatter >> sequenceFeature [ ^ sequenceFeature ] -{ #category : #accessing } +{ #category : 'accessing' } BioSequenceFeatureFormatter >> sequenceFeature: anObject [ sequenceFeature := anObject ] diff --git a/repository/BioFormatters/BioSequenceFormatter.class.st b/repository/BioFormatters/BioSequenceFormatter.class.st index ca1d218e..87150a62 100644 --- a/repository/BioFormatters/BioSequenceFormatter.class.st +++ b/repository/BioFormatters/BioSequenceFormatter.class.st @@ -5,21 +5,23 @@ A BioSequenceFormatter can format a given String (presumably a sequence) to seve " Class { - #name : #BioSequenceFormatter, - #superclass : #BioFormatter, + #name : 'BioSequenceFormatter', + #superclass : 'BioFormatter', #instVars : [ 'sequence' ], - #category : #'BioFormatters-Formatters' + #category : 'BioFormatters-Formatters', + #package : 'BioFormatters', + #tag : 'Formatters' } -{ #category : #accessing } +{ #category : 'accessing' } BioSequenceFormatter class >> identifiers [ ^ String empty ] -{ #category : #accessing } +{ #category : 'accessing' } BioSequenceFormatter class >> joinSequence: aCollection [ " Private - Answer a String with the sequence ensambled from aCollection. aCollection is a collection of collections with each element composed by Strings or Characters " @@ -27,7 +29,7 @@ BioSequenceFormatter class >> joinSequence: aCollection [ ^ (aCollection flatCollect: [: each | each select: [: elem | elem isBiologicalSequence ] ]) joinUsing: String empty ] -{ #category : #accessing } +{ #category : 'accessing' } BioSequenceFormatter >> asTriplet [ " Answer a String with the receiver's DNA or RNA sequence decoded by triplets " @@ -43,12 +45,12 @@ BioSequenceFormatter >> asTriplet [ ^ answer trimBoth ] -{ #category : #accessing } +{ #category : 'accessing' } BioSequenceFormatter >> sequence [ ^ sequence ] -{ #category : #accessing } +{ #category : 'accessing' } BioSequenceFormatter >> sequence: anObject [ sequence := anObject ] diff --git a/repository/BioFormatters/BioStandardNaming.class.st b/repository/BioFormatters/BioStandardNaming.class.st index bcbd5205..1eb45018 100644 --- a/repository/BioFormatters/BioStandardNaming.class.st +++ b/repository/BioFormatters/BioStandardNaming.class.st @@ -3,12 +3,14 @@ A standard naming is a null namer, only trims a name. " Class { - #name : #BioStandardNaming, - #superclass : #BioNaming, - #category : 'BioFormatters-Naming' + #name : 'BioStandardNaming', + #superclass : 'BioNaming', + #category : 'BioFormatters-Naming', + #package : 'BioFormatters', + #tag : 'Naming' } -{ #category : #accessing } +{ #category : 'accessing' } BioStandardNaming >> format: aString [ " See superimplementor's comment " diff --git a/repository/BioFormatters/BioVCFFormatter.class.st b/repository/BioFormatters/BioVCFFormatter.class.st index 6b8496b6..3c4b1082 100644 --- a/repository/BioFormatters/BioVCFFormatter.class.st +++ b/repository/BioFormatters/BioVCFFormatter.class.st @@ -4,12 +4,14 @@ BioSmalltalk Variant Call Format parser/writer according to The Variant Call For " Class { - #name : #BioVCFFormatter, - #superclass : #BioFileFormatter, - #category : #'BioFormatters-Formatters-VCF' + #name : 'BioVCFFormatter', + #superclass : 'BioFileFormatter', + #category : 'BioFormatters-Formatters-VCF', + #package : 'BioFormatters', + #tag : 'Formatters-VCF' } -{ #category : #examples } +{ #category : 'examples' } BioVCFFormatter class >> example01 [ | vcfReader | @@ -19,14 +21,14 @@ BioVCFFormatter class >> example01 [ Transcript show: vcfRecord; cr ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFFormatter class >> identifiers [ "Answer a of identifiers of the receiver" ^ #('VCF') ] -{ #category : #'accessing - meta' } +{ #category : 'accessing - meta' } BioVCFFormatter >> addMetaAltID: stringID description: descriptionString [ " Add the Alternative allele field format " @@ -40,7 +42,7 @@ BioVCFFormatter >> addMetaAltID: stringID description: descriptionString [ bioCr ] -{ #category : #'accessing - meta' } +{ #category : 'accessing - meta' } BioVCFFormatter >> addMetaAssemblyURL: urlString [ " Add breakpoint assemblies for structural variations may use an external file " @@ -51,7 +53,7 @@ BioVCFFormatter >> addMetaAssemblyURL: urlString [ ] -{ #category : #'accessing - meta - contig' } +{ #category : 'accessing - meta - contig' } BioVCFFormatter >> addMetaContigID: contigStringID [ " Add the contig line (not required) " @@ -63,7 +65,7 @@ BioVCFFormatter >> addMetaContigID: contigStringID [ ] -{ #category : #'accessing - meta - contig' } +{ #category : 'accessing - meta - contig' } BioVCFFormatter >> addMetaContigID: contigStringID url: urlString [ " As with chromosomal sequences it is highly recommended (but not required) that the header include tags describing the contigs referred to in the VCF le. This furthermore allows these contigs to come from different files. The format is identical to that of a reference sequence, but with an additional URL tag to indicate where that sequence can be found. " @@ -77,7 +79,7 @@ BioVCFFormatter >> addMetaContigID: contigStringID url: urlString [ ] -{ #category : #'accessing - meta' } +{ #category : 'accessing - meta' } BioVCFFormatter >> addMetaFileDate [ " Add the date line " @@ -88,7 +90,7 @@ BioVCFFormatter >> addMetaFileDate [ ] -{ #category : #'accessing - meta' } +{ #category : 'accessing - meta' } BioVCFFormatter >> addMetaFileFormat [ " Add the required first line " @@ -99,7 +101,7 @@ BioVCFFormatter >> addMetaFileFormat [ ] -{ #category : #'accessing - meta' } +{ #category : 'accessing - meta' } BioVCFFormatter >> addMetaFilter: filterIdString description: descriptionString [ " Add the filter line " @@ -113,7 +115,7 @@ BioVCFFormatter >> addMetaFilter: filterIdString description: descriptionString ] -{ #category : #'accessing - meta' } +{ #category : 'accessing - meta' } BioVCFFormatter >> addMetaFixedHeader [ " Add the header line " @@ -136,7 +138,7 @@ BioVCFFormatter >> addMetaFixedHeader [ ] -{ #category : #'accessing - meta -format' } +{ #category : 'accessing - meta -format' } BioVCFFormatter >> addMetaFormat: formatIdString number: aNumber type: typeString description: descriptionString [ " Add the filter line " @@ -154,7 +156,7 @@ BioVCFFormatter >> addMetaFormat: formatIdString number: aNumber type: typeStrin ] -{ #category : #'accessing - meta -format' } +{ #category : 'accessing - meta -format' } BioVCFFormatter >> addMetaFormatCharacter: formatIdString number: aNumber description: descriptionString [ " Add the filter line " @@ -171,7 +173,7 @@ BioVCFFormatter >> addMetaFormatCharacter: formatIdString number: aNumber descri ] -{ #category : #'accessing - meta -format' } +{ #category : 'accessing - meta -format' } BioVCFFormatter >> addMetaFormatFloat: formatIdString number: aNumber description: descriptionString [ " Add the filter line " @@ -188,7 +190,7 @@ BioVCFFormatter >> addMetaFormatFloat: formatIdString number: aNumber descriptio ] -{ #category : #'accessing - meta -format' } +{ #category : 'accessing - meta -format' } BioVCFFormatter >> addMetaFormatInteger: formatIdString number: aNumber description: descriptionString [ " Add the filter line " @@ -205,7 +207,7 @@ BioVCFFormatter >> addMetaFormatInteger: formatIdString number: aNumber descript ] -{ #category : #'accessing - meta -format' } +{ #category : 'accessing - meta -format' } BioVCFFormatter >> addMetaFormatString: formatIdString number: aNumber description: descriptionString [ " Add the filter line " @@ -222,7 +224,7 @@ BioVCFFormatter >> addMetaFormatString: formatIdString number: aNumber descripti ] -{ #category : #'accessing - meta' } +{ #category : 'accessing - meta' } BioVCFFormatter >> addMetaGenotypesHeader: sampleNames [ " Add the genotype names header line " @@ -239,7 +241,7 @@ BioVCFFormatter >> addMetaGenotypesHeader: sampleNames [ ] -{ #category : #'accessing - meta - info' } +{ #category : 'accessing - meta - info' } BioVCFFormatter >> addMetaInfoID: stringID nValues: nValInteger type: stringType description: descriptionString [ " Add the contig line (not required) " @@ -256,7 +258,7 @@ BioVCFFormatter >> addMetaInfoID: stringID nValues: nValInteger type: stringType bioCr ] -{ #category : #'accessing - meta - info' } +{ #category : 'accessing - meta - info' } BioVCFFormatter >> addMetaInfoID: stringID nValues: nValInteger type: stringType description: descriptionString source: sourceString [ " Add info line (not required) " @@ -276,7 +278,7 @@ BioVCFFormatter >> addMetaInfoID: stringID nValues: nValInteger type: stringType ] -{ #category : #'accessing - meta - info' } +{ #category : 'accessing - meta - info' } BioVCFFormatter >> addMetaInfoID: stringID nValues: nValInteger type: stringType description: descriptionString source: sourceString version: versionString [ " Add info line (not required) " @@ -298,7 +300,7 @@ BioVCFFormatter >> addMetaInfoID: stringID nValues: nValInteger type: stringType ] -{ #category : #'accessing - meta - info' } +{ #category : 'accessing - meta - info' } BioVCFFormatter >> addMetaIntegerFlagID: stringID nValues: nValInteger description: descriptionString source: sourceString version: versionString [ " Add info line (not required) " @@ -319,7 +321,7 @@ BioVCFFormatter >> addMetaIntegerFlagID: stringID nValues: nValInteger descripti ] -{ #category : #'accessing - meta - info' } +{ #category : 'accessing - meta - info' } BioVCFFormatter >> addMetaIntegerFloatID: stringID nValues: nValInteger description: descriptionString source: sourceString version: versionString [ " Add info line (not required) " @@ -340,7 +342,7 @@ BioVCFFormatter >> addMetaIntegerFloatID: stringID nValues: nValInteger descript ] -{ #category : #'accessing - meta - info' } +{ #category : 'accessing - meta - info' } BioVCFFormatter >> addMetaIntegerInfoID: stringID nValues: nValInteger description: descriptionString source: sourceString version: versionString [ " Add info line (not required) " @@ -361,7 +363,7 @@ BioVCFFormatter >> addMetaIntegerInfoID: stringID nValues: nValInteger descripti ] -{ #category : #'accessing - meta' } +{ #category : 'accessing - meta' } BioVCFFormatter >> addMetaPedigreeDB: pedigreeDBUrl [ " Add record relationships between genomes as link to pedigreeDBUrl " @@ -372,7 +374,7 @@ BioVCFFormatter >> addMetaPedigreeDB: pedigreeDBUrl [ bioCr ] -{ #category : #'accessing - meta' } +{ #category : 'accessing - meta' } BioVCFFormatter >> addMetaPedigreeNames: pedigreeNameCollection [ " Add record relationships between genomes. ##PEDIGREE= @@ -392,7 +394,7 @@ BioVCFFormatter >> addMetaPedigreeNames: pedigreeNameCollection [ bioCr ] -{ #category : #'accessing - meta' } +{ #category : 'accessing - meta' } BioVCFFormatter >> addMetaReference: refString [ " Add the reference line " @@ -403,7 +405,7 @@ BioVCFFormatter >> addMetaReference: refString [ ] -{ #category : #'accessing - meta' } +{ #category : 'accessing - meta' } BioVCFFormatter >> addMetaSampleID: stringID genomes: genomesIDCollection mixture: mixtureIDCollection description: descriptionCollection [ " Add sample to genome mappings as shown below: ##SAMPLE= @@ -423,7 +425,7 @@ BioVCFFormatter >> addMetaSampleID: stringID genomes: genomesIDCollection mixtur bioCr ] -{ #category : #'accessing - meta' } +{ #category : 'accessing - meta' } BioVCFFormatter >> addMetaSource: sourceString [ " Add the source line " @@ -434,7 +436,7 @@ BioVCFFormatter >> addMetaSource: sourceString [ ] -{ #category : #'accessing - meta - info' } +{ #category : 'accessing - meta - info' } BioVCFFormatter >> addMetaStringInfoID: stringID nValues: nValInteger description: descriptionString source: sourceString version: versionString [ " Add info line (not required) " @@ -455,7 +457,7 @@ BioVCFFormatter >> addMetaStringInfoID: stringID nValues: nValInteger descriptio ] -{ #category : #'accessing - meta' } +{ #category : 'accessing - meta' } BioVCFFormatter >> formatVersion [ " Answer a with the receiver's specification version " diff --git a/repository/BioFormatters/BioVCFRecord.class.st b/repository/BioFormatters/BioVCFRecord.class.st index d8912845..11f61dbd 100644 --- a/repository/BioFormatters/BioVCFRecord.class.st +++ b/repository/BioFormatters/BioVCFRecord.class.st @@ -5,8 +5,8 @@ The VCF fields CHROM, POS, ID, REF, ALT, QUAL, FILTER, INFO and FORMAT are avail " Class { - #name : #BioVCFRecord, - #superclass : #BioObject, + #name : 'BioVCFRecord', + #superclass : 'BioObject', #instVars : [ 'id', 'position', @@ -20,10 +20,12 @@ Class { 'samples', 'infos' ], - #category : 'BioFormatters-Formatters-VCF' + #category : 'BioFormatters-Formatters-VCF', + #package : 'BioFormatters', + #tag : 'Formatters-VCF' } -{ #category : #examples } +{ #category : 'examples' } BioVCFRecord class >> example01 [ ^ BioVCFRecord new @@ -34,7 +36,7 @@ BioVCFRecord class >> example01 [ inspect ] -{ #category : #examples } +{ #category : 'examples' } BioVCFRecord class >> example02 [ ^ BioVCFRecord new @@ -54,7 +56,7 @@ BioVCFRecord class >> example02 [ inspect ] -{ #category : #examples } +{ #category : 'examples' } BioVCFRecord class >> example03 [ " Example with FORMAT and INFO records " @@ -79,7 +81,7 @@ BioVCFRecord class >> example03 [ inspect ] -{ #category : #examples } +{ #category : 'examples' } BioVCFRecord class >> example04 [ " Example with FORMAT and INFO records " @@ -109,7 +111,7 @@ BioVCFRecord class >> example04 [ inspect ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecord >> addFormatDP [ " Set read depth at this position for this sample (Integer) " @@ -117,7 +119,7 @@ BioVCFRecord >> addFormatDP [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecord >> addFormatEC [ " Set the comma separated list of expected alternate allele counts for each alternate allele in the same order as listed in the ALT field (typically used in association analyses) (Integers) " @@ -125,7 +127,7 @@ BioVCFRecord >> addFormatEC [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecord >> addFormatFT [ " Set sample genotype filter indicating if this genotype was 'called' (similar in concept to the FILTER field). Again, use PASS to indicate that all lters have been passed, a semi-colon separated list of codes for filters that fail, or `.' to indicate that filters have not been applied. These values should be described in the metainformation in the same way as FILTERs (String, no white-space or semi-colons permitted) " @@ -133,7 +135,7 @@ BioVCFRecord >> addFormatFT [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecord >> addFormatGL [ " Set genotype likelihoods comprised of comma separated foating point log10-scaled likelihoods for all possible genotypes given the set of alleles de ned in the REF and ALT fields. In presence of the GT field the same ploidy is expected and the canonical order is used; without GT eld, diploidy is assumed. If A is the allele in REF and B,C,... are the alleles as ordered in ALT, the ordering of genotypes for the likelihoods is given by: F(j/k) = (k*(k+1)/2)+j. In other words, for biallelic sites the ordering is: AA,AB,BB; for triallelic sites the ordering is: AA,AB,BB,AC,BC,CC, etc. For example: GT:GL 0/1:-323.03,-99.29,-802.53 (Floats) " @@ -141,7 +143,7 @@ BioVCFRecord >> addFormatGL [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecord >> addFormatGLE [ " Set genotype likelihoods of heterogeneous ploidy, used in presence of uncertain copy number. For example: GLE=0:-75.22,1:-223.42,0/0:-323.03,1/0:-99.29,1/1:-802.53 (String) " @@ -149,7 +151,7 @@ GLE=0:-75.22,1:-223.42,0/0:-323.03,1/0:-99.29,1/1:-802.53 (String) " self formats add: 'GLE' ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecord >> addFormatGP [ " Set the phred-scaled genotype posterior probabilities (and otherwise de ned precisely as the GL field); intended to store imputed genotype probabilities (Floats) " @@ -157,7 +159,7 @@ BioVCFRecord >> addFormatGP [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecord >> addFormatGQ [ " Set the conditional genotype quality, encoded as a phred quality 10log10 p (genotype call is wrong, conditioned on the site's being variant) (Integer) " @@ -165,7 +167,7 @@ BioVCFRecord >> addFormatGQ [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecord >> addFormatGT [ " Set genotype, encoded as allele values separated by either of = or j. The allele values are 0 for the reference allele (what is in the REF eld), 1 for the first allele listed in ALT, 2 for the second allele list in ALT and so on. For diploid calls examples could be 0=1, 1 j 0, or 1=2, etc. For haploid calls, e.g. on Y, male nonpseudoautosomal X, or mitochondrion, only one allele value should be given; a triploid call might look like 0=0=1. If a call cannot be made for a sample at a given locus, `.' should be specified for each missing allele in the GT field (for example `:=:' for a diploid genotype and `.' for haploid genotype). The meanings of the separators are as follows (see the PS eld below for more details on incorporating phasing information into the genotypes): / : genotype unphased @@ -175,7 +177,7 @@ BioVCFRecord >> addFormatGT [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecord >> addFormatHQ [ " Set the haplotype qualities, two comma separated phred qualities (Integers) " @@ -183,7 +185,7 @@ BioVCFRecord >> addFormatHQ [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecord >> addFormatMQ [ " Set the RMS mapping quality, similar to the version in the INFO field. (Integer) " @@ -191,7 +193,7 @@ BioVCFRecord >> addFormatMQ [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecord >> addFormatPL [ " Set the phred-scaled genotype likelihoods rounded to the closest integer (and otherwise defined precisely as the GL field) (Integers) " @@ -200,7 +202,7 @@ the GL field) (Integers) " ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecord >> addFormatPQ [ " Set the phasing quality, the phred-scaled probability that alleles are ordered incorrectly in a heterozygote (against all other members in the phase set). We note that we have not yet included the specific measure for precisely defining 'phasing quality'; our intention for now is simply to reserve the PQ tag for future use as a measure of phasing quality. (Integer) " @@ -208,7 +210,7 @@ BioVCFRecord >> addFormatPQ [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecord >> addFormatPS [ " Set the phase set. A phase set is de ned as a set of phased genotypes to which this genotype belongs. Phased genotypes for an individual that are on the same chromosome and have the same PS value are in the same phased set. A phase set speci es multi-marker haplotypes for the phased genotypes in the set. All phased genotypes that do not contain a PS sub eld are assumed to belong to the same phased set. If the genotype in the GT field is unphased, the corresponding PS field is ignored. The recommended convention is to use the position of the first variant in the set as the PS identi er (although this is not required). (Non-negative 32-bit Integer) " @@ -216,21 +218,21 @@ BioVCFRecord >> addFormatPS [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecord >> addGenotypes: aCollection [ " Add aCollection to the receiver's genotypes " ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecord >> altBase [ " Answer a of alterante base(s) - alternate non-reference alleles. These alleles do not have to be called in any of the samples. Options are base Strings made up of the bases A,C,G,T,N,*, (case insensitive) or an angle-bracketed ID String (“”) or a breakend replacement string as described in the section on breakends. The ‘*’ allele is reserved to indicate that the allele is missing due to a upstream deletion. If there are no alternative alleles, then the missing value should be used. Tools processing VCF files are not required to preserve case in the allele String, except for IDs, which are case sensitive. (String; no whitespace, commas, or angle-brackets are permitted in the ID String itself) " ^ altBase ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecord >> altBase: aCollection [ " Set a of alterante base(s) - alternate non-reference alleles. Options are base Strings made up of the bases A,C,G,T,N,*, (case insensitive) or an angle-bracketed ID String (“”) or a breakend replacement string as described in the section on breakends. The ‘*’ allele is reserved to indicate that the allele is missing due to a upstream deletion. If there are no alternative alleles, then the missing value should be used. Tools processing VCF files are not required to preserve case in the allele String, except for IDs, which are case sensitive. (String; no whitespace, commas, or angle-brackets are permitted in the ID String itself) " @@ -238,7 +240,7 @@ BioVCFRecord >> altBase: aCollection [ altBase := aCollection ] -{ #category : #converting } +{ #category : 'converting' } BioVCFRecord >> asString [ " Answer a with the receiver's printed representation " @@ -263,42 +265,42 @@ BioVCFRecord >> asString [ nextPutAll: self genotypesString ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecord >> chromosome [ " Answer a with the identifier from the reference genome or an angle-bracketed ID String (“”) pointing to a contig in the assembly file (cf. the ##assembly line in the header). All entries for a specific CHROM should form a contiguous block within the VCF file. The colon symbol (:) must be absent from all chromosome names to avoid parsing errors when dealing with breakends. (String, no white-space permitted, Required). " ^ chromosome ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecord >> chromosome: aNumberOrLetter [ " Set a with the identifier from the reference genome or an angle-bracketed ID String (“”) pointing to a contig in the assembly file (cf. the ##assembly line in the header). All entries for a specific CHROM should form a contiguous block within the VCF file. The colon symbol (:) must be absent from all chromosome names to avoid parsing errors when dealing with breakends. (String, no white-space permitted, Required). " chromosome := aNumberOrLetter ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecord >> delimiter [ " Answer the used to delimit fields " ^ Character tab ] -{ #category : #'accessing - filter' } +{ #category : 'accessing - filter' } BioVCFRecord >> filter [ " Answer a with filter status: PASS if this position has passed all filters, i.e. a call is made at this position. Otherwise, if the site has not passed all filters, a semicolon-separated list of codes for filters that fail. e.g. “q10;s50” might indicate that at this site the quality is below 10 and the number of samples with data is below 50% of the total number of samples. ‘0’ is reserved and should not be used as a filter String. If filters have not been applied, then this field should be set to the missing value. (String, no white-space or semi-colons permitted " ^ filter ] -{ #category : #'accessing - filter' } +{ #category : 'accessing - filter' } BioVCFRecord >> filter: aString [ " Set a with filter status: PASS if this position has passed all filters, i.e. a call is made at this position. Otherwise, if the site has not passed all filters, a semicolon-separated list of codes for filters that fail. e.g. “q10;s50” might indicate that at this site the quality is below 10 and the number of samples with data is below 50% of the total number of samples. ‘0’ is reserved and should not be used as a filter String. If filters have not been applied, then this field should be set to the missing value. (String, no white-space or semi-colons permitted " filter := aString ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecord >> formats [ " Answer a of format identifiers " @@ -306,12 +308,12 @@ BioVCFRecord >> formats [ ifNil: [ formats := OrderedCollection new: 13 ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecord >> formats: anObject [ formats := anObject ] -{ #category : #converting } +{ #category : 'converting' } BioVCFRecord >> genotypesString [ " Answer the genotype information for the receiver as a " @@ -320,21 +322,21 @@ BioVCFRecord >> genotypesString [ nextPutAll: nil ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecord >> id [ " Answer a of unique identifiers where available. If this is a dbSNP variant it is encouraged to use the rs number(s). No identifier should be present in more than one data record. If there is no identifier available, then the missing value should be used. (String, no white-space or semi-colons permitted) " ^ id ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecord >> id: aCollection [ " See #id " id := aCollection ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecord >> infoFields [ ^ Dictionary new @@ -359,7 +361,7 @@ BioVCFRecord >> infoFields [ yourself ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecord >> position [ " Answer a with the reference position, with the 1st base having position 1. Positions are sorted numerically, in increasing order, within each reference sequence CHROM. It is permitted to have multiple records with the same POS. Telomeres are indicated by using positions 0 or N+1, where N is the length of the corresponding chromosome or contig. (Integer, Required) " @@ -367,35 +369,35 @@ same POS. Telomeres are indicated by using positions 0 or N+1, where N is the le ^ position ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecord >> position: aNumber [ " Set a with the reference position, with the 1st base having position 1. Positions are sorted numerically, in increasing order, within each reference sequence CHROM. It is permitted to have multiple records with the same POS. Telomeres are indicated by using positions 0 or N+1, where N is the length of the corresponding chromosome or contig. (Integer, Required) " position := aNumber ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecord >> quality [ " Answer a of Phred-scaled quality score for the assertion made in ALT. i.e. − 10 log10 prob(call in ALT is wrong). If ALT is ‘.’ (no variant) then this is - 10 log10 prob(variant), and if ALT is not ‘.’ this is − 10 log10 prob(no variant). If unknown, the missing value should be specified." ^ quality ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecord >> quality: aNumber [ " Set a of Phred-scaled quality score for the assertion made in ALT. i.e. − 10 log10 prob(call in ALT is wrong). If ALT is ‘.’ (no variant) then this is - 10 log10 prob(variant), and if ALT is not ‘.’ this is − 10 log10 prob(no variant). If unknown, the missing value should be specified." quality := aNumber ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecord >> refBase [ " Answer a of reference base(s). Each base must be one of A,C,G,T,N (case insensitive). Multiple bases are permitted. The value in the POS field refers to the position of the first base in the String. For simple insertions and deletions in which either the REF or one of the ALT alleles would otherwise be null/empty, the REF and ALT Strings must include the base before the event (which must be reflected in the POS field), unless the event occurs at position 1 on the contig in which case it must include the base after the event; this padding base is not required (although it is permitted) for e.g. complex substitutions or other events where all alleles have at least one base represented in their Strings. If any of the ALT alleles is a symbolic allele (an angle-bracketed ID String “”) then the padding base is required and POS denotes the coordinate of the base preceding the polymorphism. Tools processing VCF files are not required to preserve case in the allele Strings. (String, Required). " ^ refBase ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecord >> refBase: aString [ " Set a of reference base(s): A,C,G,T,N" @@ -403,7 +405,7 @@ BioVCFRecord >> refBase: aString [ refBase := aString ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecord >> samples [ " Answer a of with genotype calls " @@ -412,7 +414,7 @@ BioVCFRecord >> samples [ ] -{ #category : #'accessing - filter' } +{ #category : 'accessing - filter' } BioVCFRecord >> setFilterAsPASSED [ " Set a with filter status: PASS as this position has passed all filters, i.e. a call is made at this position. " @@ -420,63 +422,63 @@ BioVCFRecord >> setFilterAsPASSED [ ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecord >> setInfoAF: aNumber [ " Set aNumber of allele frequency for each ALT allele in the same order as listed: use this when estimated from primary data, not called genotypes" self info at: 'AF' put: aNumber ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecord >> setInfoAN: aNumber [ " Set aNumber of total number of alleles in called genotypes " self info at: 'AN' put: aNumber ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecord >> setInfoCIGAR: aString [ " Set aString cigar string describing how to align an alternate allele to the reference allele " self info at: 'CIGAR' put: aString ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecord >> setInfoDB [ " Set dbSNP membership " self info at: 'DB' put: nil ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecord >> setInfoDP: aNumber [ " Set aNumber of combined depth across samples" self info at: 'DP' put: aNumber ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecord >> setInfoH2 [ " Set hapmap2 membership " self info at: 'H2' put: nil ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecord >> setInfoH3 [ " Set hapmap3 membership " self info at: 'H3' put: nil ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecord >> setInfoNS: aNumber [ " Set aNumber of samples with data" self info at: 'NS' put: aNumber ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecord >> setInfoRMS: aNumber [ " Set aNumber of RMS mapping quality " diff --git a/repository/BioFormatters/BioVCFRecordSample.class.st b/repository/BioFormatters/BioVCFRecordSample.class.st index dfe9fd09..88262efc 100644 --- a/repository/BioFormatters/BioVCFRecordSample.class.st +++ b/repository/BioFormatters/BioVCFRecordSample.class.st @@ -1,6 +1,6 @@ Class { - #name : #BioVCFRecordSample, - #superclass : #BioNamedObject, + #name : 'BioVCFRecordSample', + #superclass : 'BioNamedObject', #instVars : [ 'vcfRecord', 'genotype', @@ -8,10 +8,12 @@ Class { 'haplotypeQuality', 'genotypeQuality' ], - #category : 'BioFormatters-Formatters-VCF' + #category : 'BioFormatters-Formatters-VCF', + #package : 'BioFormatters', + #tag : 'Formatters-VCF' } -{ #category : #examples } +{ #category : 'examples' } BioVCFRecordSample class >> example01 [ ^ BioVCFRecordSample new @@ -24,7 +26,7 @@ BioVCFRecordSample class >> example01 [ ] -{ #category : #examples } +{ #category : 'examples' } BioVCFRecordSample class >> example02 [ ^ BioVCFRecordSample new @@ -36,66 +38,66 @@ BioVCFRecordSample class >> example02 [ yourself ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecordSample >> genotype [ ^ genotype ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecordSample >> genotype: anObject [ genotype := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecordSample >> genotypeDelimiter [ " Answer a " ^ $| ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecordSample >> genotypeQuality [ ^ genotypeQuality ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecordSample >> genotypeQuality: anObject [ genotypeQuality := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecordSample >> haplotypeQuality [ ^ haplotypeQuality ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecordSample >> haplotypeQuality: anObject [ haplotypeQuality := anObject ] -{ #category : #printing } +{ #category : 'printing' } BioVCFRecordSample >> printOn: aStream [ " Private - See superclass implementor " aStream nextPutAll: self name ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecordSample >> readDepth [ ^ readDepth ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecordSample >> readDepth: anObject [ readDepth := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecordSample >> vcfRecord [ ^ vcfRecord ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecordSample >> vcfRecord: anObject [ vcfRecord := anObject ] diff --git a/repository/BioFormatters/BioVCFRecordWriter.class.st b/repository/BioFormatters/BioVCFRecordWriter.class.st index dc7f4ee4..41702051 100644 --- a/repository/BioFormatters/BioVCFRecordWriter.class.st +++ b/repository/BioFormatters/BioVCFRecordWriter.class.st @@ -1,27 +1,29 @@ Class { - #name : #BioVCFRecordWriter, - #superclass : #BioObject, + #name : 'BioVCFRecordWriter', + #superclass : 'BioObject', #instVars : [ 'vcfRecord', 'formatStream', 'infoStream' ], - #category : 'BioFormatters-Formatters-VCF' + #category : 'BioFormatters-Formatters-VCF', + #package : 'BioFormatters', + #tag : 'Formatters-VCF' } -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecordWriter >> appendFormatDelimiter [ self hasFormatField ifTrue: [ self formatStream nextPut: $: ] ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecordWriter >> appendInfoDelimiter [ self hasInfoFields ifTrue: [ self infoStream nextPut: $; ] ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecordWriter >> formatStream [ " Answer a with additional information. See #formatString " @@ -30,28 +32,28 @@ BioVCFRecordWriter >> formatStream [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecordWriter >> formatString [ " Answer a with format information. " ^ self formatStream contents ] -{ #category : #testing } +{ #category : 'testing' } BioVCFRecordWriter >> hasFormatField [ " Answer if the receiver has set any of the format fields " ^ self formatString notEmpty ] -{ #category : #testing } +{ #category : 'testing' } BioVCFRecordWriter >> hasInfoFields [ " Answer if the receiver has set any of the info fields " ^ self infoString notEmpty ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecordWriter >> info: aString [ " Set a with additional information: (String, no white-space, semi-colons, or equals-signs permitted; commas are permitted only as delimiters for lists of values) INFO fields are encoded as a semicolon-separated series of short keys with optional values in the format: = [,data]. Arbitrary keys are permitted " @@ -59,7 +61,7 @@ BioVCFRecordWriter >> info: aString [ infoStream := WriteStream on: aString ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecordWriter >> infoStream [ " Answer a with additional information. See #infoString " @@ -68,14 +70,14 @@ BioVCFRecordWriter >> infoStream [ ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecordWriter >> infoString [ " Answer a with additional information: (String, no white-space, semi-colons, or equals-signs permitted; commas are permitted only as delimiters for lists of values) INFO fields are encoded as a semicolon-separated series of short keys with optional values in the format: = [,data]. Arbitrary keys are permitted, although the following sub-fields are reserved (albeit optional) " ^ self infoStream asString ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecordWriter >> printFormatDP [ " Set read depth at this position for this sample (Integer) " @@ -84,7 +86,7 @@ BioVCFRecordWriter >> printFormatDP [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecordWriter >> printFormatEC [ " Set the comma separated list of expected alternate allele counts for each alternate allele in the same order as listed in the ALT field (typically used in association analyses) (Integers) " @@ -93,7 +95,7 @@ BioVCFRecordWriter >> printFormatEC [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecordWriter >> printFormatFT [ " Set sample genotype filter indicating if this genotype was 'called' (similar in concept to the FILTER field). Again, use PASS to indicate that all lters have been passed, a semi-colon separated list of codes for filters that fail, or `.' to indicate that filters have not been applied. These values should be described in the metainformation in the same way as FILTERs (String, no white-space or semi-colons permitted) " @@ -102,7 +104,7 @@ BioVCFRecordWriter >> printFormatFT [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecordWriter >> printFormatGL [ " Set genotype likelihoods comprised of comma separated foating point log10-scaled likelihoods for all possible genotypes given the set of alleles de ned in the REF and ALT fields. In presence of the GT field the same ploidy is expected and the canonical order is used; without GT eld, diploidy is assumed. If A is the allele in REF and B,C,... are the alleles as ordered in ALT, the ordering of genotypes for the likelihoods is given by: F(j/k) = (k*(k+1)/2)+j. In other words, for biallelic sites the ordering is: AA,AB,BB; for triallelic sites the ordering is: AA,AB,BB,AC,BC,CC, etc. For example: GT:GL 0/1:-323.03,-99.29,-802.53 (Floats) " @@ -111,7 +113,7 @@ BioVCFRecordWriter >> printFormatGL [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecordWriter >> printFormatGLE [ " Set genotype likelihoods of heterogeneous ploidy, used in presence of uncertain copy number. For example: GLE=0:-75.22,1:-223.42,0/0:-323.03,1/0:-99.29,1/1:-802.53 (String) " @@ -120,7 +122,7 @@ GLE=0:-75.22,1:-223.42,0/0:-323.03,1/0:-99.29,1/1:-802.53 (String) " self formatStream nextPutAll: 'GLE' ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecordWriter >> printFormatGP [ " Set the phred-scaled genotype posterior probabilities (and otherwise de ned precisely as the GL field); intended to store imputed genotype probabilities (Floats) " @@ -129,7 +131,7 @@ BioVCFRecordWriter >> printFormatGP [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecordWriter >> printFormatGQ [ " Set the conditional genotype quality, encoded as a phred quality 10log10 p (genotype call is wrong, conditioned on the site's being variant) (Integer) " @@ -138,7 +140,7 @@ BioVCFRecordWriter >> printFormatGQ [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecordWriter >> printFormatGT [ " Set genotype, encoded as allele values separated by either of = or j. The allele values are 0 for the reference allele (what is in the REF eld), 1 for the first allele listed in ALT, 2 for the second allele list in ALT and so on. For diploid calls examples could be 0=1, 1 j 0, or 1=2, etc. For haploid calls, e.g. on Y, male nonpseudoautosomal X, or mitochondrion, only one allele value should be given; a triploid call might look like 0=0=1. If a call cannot be made for a sample at a given locus, `.' should be specified for each missing allele in the GT field (for example `:=:' for a diploid genotype and `.' for haploid genotype). The meanings of the separators are as follows (see the PS eld below for more details on incorporating phasing information into the genotypes): / : genotype unphased @@ -149,7 +151,7 @@ BioVCFRecordWriter >> printFormatGT [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecordWriter >> printFormatHQ [ " Set the haplotype qualities, two comma separated phred qualities (Integers) " @@ -158,7 +160,7 @@ BioVCFRecordWriter >> printFormatHQ [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecordWriter >> printFormatMQ [ " Set the RMS mapping quality, similar to the version in the INFO field. (Integer) " @@ -167,7 +169,7 @@ BioVCFRecordWriter >> printFormatMQ [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecordWriter >> printFormatPL [ " Set the phred-scaled genotype likelihoods rounded to the closest integer (and otherwise defined precisely as the GL field) (Integers) " @@ -177,7 +179,7 @@ the GL field) (Integers) " ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecordWriter >> printFormatPQ [ " Set the phasing quality, the phred-scaled probability that alleles are ordered incorrectly in a heterozygote (against all other members in the phase set). We note that we have not yet included the specific measure for precisely defining 'phasing quality'; our intention for now is simply to reserve the PQ tag for future use as a measure of phasing quality. (Integer) " @@ -186,7 +188,7 @@ BioVCFRecordWriter >> printFormatPQ [ ] -{ #category : #'accessing - format' } +{ #category : 'accessing - format' } BioVCFRecordWriter >> printFormatPS [ " Set the phase set. A phase set is de ned as a set of phased genotypes to which this genotype belongs. Phased genotypes for an individual that are on the same chromosome and have the same PS value are in the same phased set. A phase set speci es multi-marker haplotypes for the phased genotypes in the set. All phased genotypes that do not contain a PS sub eld are assumed to belong to the same phased set. If the genotype in the GT field is unphased, the corresponding PS field is ignored. The recommended convention is to use the position of the first variant in the set as the PS identi er (although this is not required). (Non-negative 32-bit Integer) " @@ -195,7 +197,7 @@ BioVCFRecordWriter >> printFormatPS [ ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecordWriter >> printInfoAF: aNumber [ " Set aNumber of allele frequency for each ALT allele in the same order as listed: use this when estimated from primary data, not called genotypes" @@ -205,7 +207,7 @@ BioVCFRecordWriter >> printInfoAF: aNumber [ nextPutAll: aNumber asString ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecordWriter >> printInfoAN: aNumber [ " Set aNumber of total number of alleles in called genotypes " @@ -215,7 +217,7 @@ BioVCFRecordWriter >> printInfoAN: aNumber [ nextPutAll: aNumber asString ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecordWriter >> printInfoCIGAR: aString [ " Set aString cigar string describing how to align an alternate allele to the reference allele " @@ -225,7 +227,7 @@ BioVCFRecordWriter >> printInfoCIGAR: aString [ nextPutAll: aString ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecordWriter >> printInfoDB [ " Set dbSNP membership " @@ -234,7 +236,7 @@ BioVCFRecordWriter >> printInfoDB [ nextPutAll: 'DB' ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecordWriter >> printInfoDP: aNumber [ " Set aNumber of combined depth across samples" @@ -244,7 +246,7 @@ BioVCFRecordWriter >> printInfoDP: aNumber [ nextPutAll: aNumber asString ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecordWriter >> printInfoH2 [ " Set hapmap2 membership " @@ -253,7 +255,7 @@ BioVCFRecordWriter >> printInfoH2 [ nextPutAll: 'H2' ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecordWriter >> printInfoH3 [ " Set hapmap3 membership " @@ -262,7 +264,7 @@ BioVCFRecordWriter >> printInfoH3 [ nextPutAll: 'H3' ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecordWriter >> printInfoNS: aNumber [ " Set aNumber of samples with data" @@ -272,7 +274,7 @@ BioVCFRecordWriter >> printInfoNS: aNumber [ nextPutAll: aNumber asString ] -{ #category : #'accessing - info' } +{ #category : 'accessing - info' } BioVCFRecordWriter >> printInfoRMS: aNumber [ " Set aNumber of RMS mapping quality " @@ -282,12 +284,12 @@ BioVCFRecordWriter >> printInfoRMS: aNumber [ nextPutAll: aNumber asString ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecordWriter >> vcfRecord [ ^ vcfRecord ] -{ #category : #accessing } +{ #category : 'accessing' } BioVCFRecordWriter >> vcfRecord: anObject [ vcfRecord := anObject ] diff --git a/repository/BioFormatters/BioXMLFormatter.class.st b/repository/BioFormatters/BioXMLFormatter.class.st index 2199e882..c8b98263 100644 --- a/repository/BioFormatters/BioXMLFormatter.class.st +++ b/repository/BioFormatters/BioXMLFormatter.class.st @@ -1,24 +1,26 @@ Class { - #name : #BioXMLFormatter, - #superclass : #BioFileFormatter, - #category : #'BioFormatters-Formatters' + #name : 'BioXMLFormatter', + #superclass : 'BioFileFormatter', + #category : 'BioFormatters-Formatters', + #package : 'BioFormatters', + #tag : 'Formatters' } -{ #category : #accessing } +{ #category : 'accessing' } BioXMLFormatter class >> description [ " Answer a Collection of identifiers of the receiver " ^ 'XML Format Writer' ] -{ #category : #accessing } +{ #category : 'accessing' } BioXMLFormatter class >> formatExtension [ "Answer a corresponding for the receiver's file output format" ^ 'xml' ] -{ #category : #accessing } +{ #category : 'accessing' } BioXMLFormatter class >> identifiers [ "Answer a of identifiers of the receiver" diff --git a/repository/BioFormatters/Dictionary.extension.st b/repository/BioFormatters/Dictionary.extension.st index d15cedff..cd3c3eb6 100644 --- a/repository/BioFormatters/Dictionary.extension.st +++ b/repository/BioFormatters/Dictionary.extension.st @@ -1,6 +1,6 @@ -Extension { #name : #Dictionary } +Extension { #name : 'Dictionary' } -{ #category : #'*BioFormatters' } +{ #category : '*BioFormatters' } Dictionary >> dumpCSVTo: aStream [ " Write the receiver contents in the following CSV format: diff --git a/repository/BioFormatters/Object.extension.st b/repository/BioFormatters/Object.extension.st index 487e7fa3..387dbeec 100644 --- a/repository/BioFormatters/Object.extension.st +++ b/repository/BioFormatters/Object.extension.st @@ -1,6 +1,6 @@ -Extension { #name : #Object } +Extension { #name : 'Object' } -{ #category : #'*BioFormatters' } +{ #category : '*BioFormatters' } Object >> getExtensionFor: fileFormatName [ " Answer the corresponding file extension of fileFormatName " diff --git a/repository/BioFormatters/PMVector.extension.st b/repository/BioFormatters/PMVector.extension.st index 6fdd8341..a10f9c71 100644 --- a/repository/BioFormatters/PMVector.extension.st +++ b/repository/BioFormatters/PMVector.extension.st @@ -1,6 +1,6 @@ -Extension { #name : #PMVector } +Extension { #name : 'PMVector' } -{ #category : #'*BioFormatters' } +{ #category : '*BioFormatters' } PMVector >> asFastaRecord [ " Answer a . Assume receiver with 18 elements " @@ -12,21 +12,21 @@ PMVector >> asFastaRecord [ ] -{ #category : #'*BioFormatters' } +{ #category : '*BioFormatters' } PMVector >> containsSequenceId [ " Answer if the receiver has a which serves as identifier " ^ self anySatisfy: #isString ] -{ #category : #'*BioFormatters' } +{ #category : '*BioFormatters' } PMVector >> containsSequenceString [ " Answer if the receiver has a sequence " ^ self anySatisfy: #isBiologicalSequence. ] -{ #category : #'*BioFormatters' } +{ #category : '*BioFormatters' } PMVector >> dumpCSVTo: aStream [ self flag: #workNeeded. @@ -36,13 +36,13 @@ PMVector >> dumpCSVTo: aStream [ nextPut: $; ] ] -{ #category : #'*BioFormatters' } +{ #category : '*BioFormatters' } PMVector >> isValidForCSVFormat [ ^ self notEmpty. ] -{ #category : #'*BioFormatters' } +{ #category : '*BioFormatters' } PMVector >> isValidForFastaFormat [ " Answer if the receiver has enough data to be translated to Fasta format " diff --git a/repository/BioFormatters/package.st b/repository/BioFormatters/package.st index c203366a..111b0869 100644 --- a/repository/BioFormatters/package.st +++ b/repository/BioFormatters/package.st @@ -1 +1 @@ -Package { #name : #BioFormatters } +Package { #name : 'BioFormatters' } diff --git a/repository/BioParsers/BioAbstractALParser.class.st b/repository/BioParsers/BioAbstractALParser.class.st index ec9729a6..e1880825 100644 --- a/repository/BioParsers/BioAbstractALParser.class.st +++ b/repository/BioParsers/BioAbstractALParser.class.st @@ -7,12 +7,14 @@ dbj|accession|locus " Class { - #name : #BioAbstractALParser, - #superclass : #BioNCBILocusParser, - #category : 'BioParsers-Core' + #name : 'BioAbstractALParser', + #superclass : 'BioNCBILocusParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioAbstractALParser >> initialize [ super initialize. diff --git a/repository/BioParsers/BioAbstractParser.class.st b/repository/BioParsers/BioAbstractParser.class.st index d83d2308..4ac230e6 100644 --- a/repository/BioParsers/BioAbstractParser.class.st +++ b/repository/BioParsers/BioAbstractParser.class.st @@ -2,39 +2,41 @@ Abstract class for BioSmalltalk parsers " Class { - #name : #BioAbstractParser, - #superclass : #BioObject, + #name : 'BioAbstractParser', + #superclass : 'BioObject', #instVars : [ 'parser', 'expression', 'results', 'status' ], - #category : #'BioParsers-Core' + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioAbstractParser class >> on: aString [ " Answer a new instance of the receiver configured for parsing aString " ^ self new initializeWith: aString ] -{ #category : #accessing } +{ #category : 'accessing' } BioAbstractParser >> beFailed [ " Private - Set the receiver's status to , meaning a failed operation was performed " status := false ] -{ #category : #accessing } +{ #category : 'accessing' } BioAbstractParser >> beSuccess [ " Private - Set the receiver's status to , meaning a successfull operation was performed " status := true ] -{ #category : #'accessing private' } +{ #category : 'accessing private' } BioAbstractParser >> buildResults: aCollection [ " Set the receiver's results using aCollection. Answer aCollection " @@ -44,7 +46,7 @@ BioAbstractParser >> buildResults: aCollection [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioAbstractParser >> buildTokens: aCollection [ " Answer an identified object for the receiver's parsing output " @@ -52,7 +54,7 @@ BioAbstractParser >> buildTokens: aCollection [ ^ self results ] -{ #category : #accessing } +{ #category : 'accessing' } BioAbstractParser >> debug [ " Private - Debug the receiver's expression " @@ -61,7 +63,7 @@ BioAbstractParser >> debug [ ^ results ] -{ #category : #accessing } +{ #category : 'accessing' } BioAbstractParser >> debug: aString [ " Debug aString with the receiver's parser " @@ -69,7 +71,7 @@ BioAbstractParser >> debug: aString [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioAbstractParser >> debugString: aString [ " Answer an object with the result of parsing aString with the receiver's parser " @@ -82,19 +84,19 @@ BioAbstractParser >> debugString: aString [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioAbstractParser >> expression [ " Answer a String with the receiver's target expression " ^ expression ] -{ #category : #accessing } +{ #category : 'accessing' } BioAbstractParser >> expression: anObject [ expression := anObject ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioAbstractParser >> initializeWith: aString [ " Private - Set the receiver's target expression to be parsed to aString " @@ -102,14 +104,14 @@ BioAbstractParser >> initializeWith: aString [ expression := aString ] -{ #category : #testing } +{ #category : 'testing' } BioAbstractParser >> isSuccess [ " Answer if the last operation in the receiver was successfull " ^ status ] -{ #category : #accessing } +{ #category : 'accessing' } BioAbstractParser >> parse [ " Private - Parse the receiver's expression if necessary. Answer the result of parsing the expresion " @@ -119,7 +121,7 @@ BioAbstractParser >> parse [ ^ results ] -{ #category : #accessing } +{ #category : 'accessing' } BioAbstractParser >> parse: aString [ " Answer an object with the result of parsing aString with the receiver's parser " @@ -130,13 +132,13 @@ BioAbstractParser >> parse: aString [ ifFalse: [ self signalInvalidObject: parseResults ]. ] -{ #category : #accessing } +{ #category : 'accessing' } BioAbstractParser >> parseResultClass [ ^ self subclassResponsibility ] -{ #category : #accessing } +{ #category : 'accessing' } BioAbstractParser >> parseString: aString [ " Answer an object with the result of parsing aString with the receiver's parser " @@ -149,21 +151,21 @@ BioAbstractParser >> parseString: aString [ ] -{ #category : #'accessing private' } +{ #category : 'accessing private' } BioAbstractParser >> parser [ "Answer the value of parser" ^ parser ] -{ #category : #'accessing private' } +{ #category : 'accessing private' } BioAbstractParser >> parser: anObject [ "Set the value of parser" parser := anObject ] -{ #category : #printing } +{ #category : 'printing' } BioAbstractParser >> printOn: aStream [ " Private - See superimplementor's comment " @@ -179,14 +181,14 @@ BioAbstractParser >> printOn: aStream [ nextPut: $] ] -{ #category : #'accessing private' } +{ #category : 'accessing private' } BioAbstractParser >> resultClass [ " Answer a default class for storing the receiver's parsing results " ^ OrderedCollection ] -{ #category : #accessing } +{ #category : 'accessing' } BioAbstractParser >> results [ " Answer an object suitable for storing receiver's parsing results " @@ -194,12 +196,12 @@ BioAbstractParser >> results [ ifNil: [ results := self resultClass new ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioAbstractParser >> results: anObject [ results := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioAbstractParser >> resultsForParse [ " Answer an object suitable for storing receiver's parsing results " @@ -207,7 +209,7 @@ BioAbstractParser >> resultsForParse [ ifNil: [ results := self parseResultClass new ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioAbstractParser >> resultsForTokenize [ " Answer an object suitable for storing receiver's parsing results " @@ -215,7 +217,7 @@ BioAbstractParser >> resultsForTokenize [ ifNil: [ results := self tokenizeResultClass new ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioAbstractParser >> rowsDo: aBlock [ " Iterate over the receiver performing aBlock on each iteration " @@ -225,7 +227,7 @@ BioAbstractParser >> rowsDo: aBlock [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioAbstractParser >> tokenize [ " Private - Tokenize the receiver's expression if necessary " @@ -234,7 +236,7 @@ BioAbstractParser >> tokenize [ ifFalse: [ self error: 'Results not empty' ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioAbstractParser >> tokenize: aString [ " Answer an object with the result of tokenizing aString with the receiver's parser " @@ -246,7 +248,7 @@ BioAbstractParser >> tokenize: aString [ ifFalse: [ parseResults ]. ] -{ #category : #'accessing private' } +{ #category : 'accessing private' } BioAbstractParser >> tokenizeResultClass [ " Answer the parse result class " diff --git a/repository/BioParsers/BioAbstractTextParser.class.st b/repository/BioParsers/BioAbstractTextParser.class.st index 3e79fe0a..b601a9ea 100644 --- a/repository/BioParsers/BioAbstractTextParser.class.st +++ b/repository/BioParsers/BioAbstractTextParser.class.st @@ -2,12 +2,14 @@ BioAbstractTextParser is an abstract class which groups common behavior for subclasses. Mostly related with parsing of structured text. " Class { - #name : #BioAbstractTextParser, - #superclass : #BioAbstractParser, - #category : #'BioParsers-Core' + #name : 'BioAbstractTextParser', + #superclass : 'BioAbstractParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #'accessing private' } +{ #category : 'accessing private' } BioAbstractTextParser >> accessionFrom: aCollection [ " Answer a new accession object using aCollection. Assume aCollection contains two elements, @@ -22,7 +24,7 @@ BioAbstractTextParser >> accessionFrom: aCollection [ yourself ] -{ #category : #'accessing private' } +{ #category : 'accessing private' } BioAbstractTextParser >> alphabetClass [ " Private - Let the proper sequence class guess the alphabet from the sequence String " @@ -30,14 +32,14 @@ BioAbstractTextParser >> alphabetClass [ ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioAbstractTextParser >> noneOf: aCollection [ " Answer a parser for parsing any kind of description text in a FASTA sequence " ^ PP2PredicateObjectNode noneOf: aCollection ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioAbstractTextParser >> parserForAccession [ " Answer a parser for parsing exactly aCollection " @@ -48,21 +50,21 @@ BioAbstractTextParser >> parserForAccession [ ^ (accession , versionNumber) flatten ==> [ :a | (a substrings: '.') asArray ] ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioAbstractTextParser >> parserForDNAAlignment [ " Answer a parser for alignments, meaning sequences containing gaps " ^ #dnaAmbiguousLetterGapped asPParser ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioAbstractTextParser >> parserForExactly: aCollection [ " Answer a parser for parsing exactly aCollection " ^ aCollection asPParser negate plus , aCollection asPParser. ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioAbstractTextParser >> parserForNonBreakingString [ ^ (self noneOf: (Array with: Character cr with: Character lf)) plus flatten diff --git a/repository/BioParsers/BioAccessionParser.class.st b/repository/BioParsers/BioAccessionParser.class.st index 0b9a7a46..8e50381b 100644 --- a/repository/BioParsers/BioAccessionParser.class.st +++ b/repository/BioParsers/BioAccessionParser.class.st @@ -1,17 +1,19 @@ Class { - #name : #BioAccessionParser, - #superclass : #BioNCBIIdParser, - #category : #'BioParsers-Core' + #name : 'BioAccessionParser', + #superclass : 'BioNCBIIdParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioAccessionParser class >> tokenize: aString [ " Tokenize aString using the receiver " ^ self tokenizeAccession: aString ] -{ #category : #accessing } +{ #category : 'accessing' } BioAccessionParser >> accessionParser [ " Answer a parser for parsing accession identifiers " @@ -31,7 +33,7 @@ BioAccessionParser >> accessionParser [ ] -{ #category : #'accessing private' } +{ #category : 'accessing private' } BioAccessionParser >> buildResults: aCollection [ " Answer a new accession object from results taken from aCollection " @@ -43,7 +45,7 @@ BioAccessionParser >> buildResults: aCollection [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioAccessionParser >> buildTokens: aCollection [ " Answer a Collection object for the receiver's parsing output " @@ -53,7 +55,7 @@ BioAccessionParser >> buildTokens: aCollection [ ^ self results ] -{ #category : #initialization } +{ #category : 'initialization' } BioAccessionParser >> initialize [ " Private - See superimplementor's comment " @@ -61,14 +63,14 @@ BioAccessionParser >> initialize [ parser := self accessionParser. ] -{ #category : #testing } +{ #category : 'testing' } BioAccessionParser >> isAccession [ " (BioAccessionParser on: 'AF288373.2') isAccession " ^ (self parse: self expression) isNotEmpty ] -{ #category : #accessing } +{ #category : 'accessing' } BioAccessionParser >> tokenizeAccession: aString [ " Refer to comment in class side " diff --git a/repository/BioParsers/BioAmbiguousBaseParser.class.st b/repository/BioParsers/BioAmbiguousBaseParser.class.st index 5a86ffa2..e072ac60 100644 --- a/repository/BioParsers/BioAmbiguousBaseParser.class.st +++ b/repository/BioParsers/BioAmbiguousBaseParser.class.st @@ -2,21 +2,23 @@ This class supports parsing DNA sequences with degenerate bases, i.e. of the form : 'A[A/C]CTG' or 'AT[A/C]TA[C/A]'. " Class { - #name : #BioAmbiguousBaseParser, - #superclass : #BioAbstractTextParser, + #name : 'BioAmbiguousBaseParser', + #superclass : 'BioAbstractTextParser', #instVars : [ 'ambParser' ], - #category : #'BioParsers-Core' + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioAmbiguousBaseParser >> ambParser [ ^ ambParser ] -{ #category : #accessing } +{ #category : 'accessing' } BioAmbiguousBaseParser >> buildResults: aCollection [ " Set the receiver's results using aCollection " @@ -26,7 +28,7 @@ BioAmbiguousBaseParser >> buildResults: aCollection [ ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioAmbiguousBaseParser >> convertAmbiguousToSingleBase: ambTokens [ " Take a String of the form '[A/C]' and convert it to a single base letter as specified by the IUPAC nomenclature. Answer a " @@ -39,7 +41,7 @@ BioAmbiguousBaseParser >> convertAmbiguousToSingleBase: ambTokens [ ifFalse: [ self convertDelimitedAmbiguousToSingleBase: amb ]. ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioAmbiguousBaseParser >> convertContinuousAmbiguousToSingleBase: ambTokens [ | motif | @@ -48,7 +50,7 @@ BioAmbiguousBaseParser >> convertContinuousAmbiguousToSingleBase: ambTokens [ ^ BioIUPACAmbiguousDNA ambiguousLettersMap at: motif ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioAmbiguousBaseParser >> convertDelimitedAmbiguousToSingleBase: ambTokens [ | motif | @@ -57,14 +59,14 @@ BioAmbiguousBaseParser >> convertDelimitedAmbiguousToSingleBase: ambTokens [ ^ BioIUPACAmbiguousDNA ambiguousLettersMap at: motif ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioAmbiguousBaseParser >> delimiter [ " Answer the Character used to delimit degenerate bases " ^ $/ ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioAmbiguousBaseParser >> parseWithSeparators [ ambParser := self parserForAmbiguityDelimited. @@ -72,7 +74,7 @@ BioAmbiguousBaseParser >> parseWithSeparators [ ^ self parse ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioAmbiguousBaseParser >> parseWithoutSeparators [ ambParser := self parserForAmbiguity. @@ -80,7 +82,7 @@ BioAmbiguousBaseParser >> parseWithoutSeparators [ ^ self parse ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioAmbiguousBaseParser >> parserForAmbiguity [ " Answer a parser for parsing a sequence variation of the type [AC] or [CT], etc. " @@ -93,7 +95,7 @@ BioAmbiguousBaseParser >> parserForAmbiguity [ ^ (open , letters , close) ==> [: ambTokens | self convertAmbiguousToSingleBase: ambTokens ] ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioAmbiguousBaseParser >> parserForAmbiguityDelimited [ " Answer a parser for parsing a sequence variation of the type [A/C] or [C/T], etc. " @@ -107,7 +109,7 @@ BioAmbiguousBaseParser >> parserForAmbiguityDelimited [ ^ (open , letter , separator , letter , close) ==> [ : ambTokens | self convertAmbiguousToSingleBase: ambTokens ] ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioAmbiguousBaseParser >> parserForAmbiguousBase [ " Answer a parser for parsing degenerate base symbols " @@ -117,7 +119,7 @@ BioAmbiguousBaseParser >> parserForAmbiguousBase [ ^ (dnaSeq / self ambParser) plus ==> [ : nodes | (nodes joinUsing: Array empty) joinUsing: String empty ] ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioAmbiguousBaseParser >> tokenizeWithSeparators [ ambParser := self parserForAmbiguityDelimited. @@ -125,7 +127,7 @@ BioAmbiguousBaseParser >> tokenizeWithSeparators [ ^ self tokenize ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioAmbiguousBaseParser >> tokenizeWithoutSeparators [ ambParser := self parserForAmbiguity. diff --git a/repository/BioParsers/BioBlastContainerNode.class.st b/repository/BioParsers/BioBlastContainerNode.class.st index 1dcc2f50..7b30c887 100644 --- a/repository/BioParsers/BioBlastContainerNode.class.st +++ b/repository/BioParsers/BioBlastContainerNode.class.st @@ -1,13 +1,15 @@ Class { - #name : #BioBlastContainerNode, - #superclass : #BioBlastNode, + #name : 'BioBlastContainerNode', + #superclass : 'BioBlastNode', #instVars : [ 'nodes' ], - #category : 'BioParsers-Support' + #category : 'BioParsers-Support', + #package : 'BioParsers', + #tag : 'Support' } -{ #category : #comparing } +{ #category : 'comparing' } BioBlastContainerNode >> = aBioBlastNode [ " Answer whether the receiver and anObject represent the same object. " @@ -15,7 +17,7 @@ BioBlastContainerNode >> = aBioBlastNode [ ] -{ #category : #enumerating } +{ #category : 'enumerating' } BioBlastContainerNode >> collect: aBlock [ "Evaluate aBlock with each of the receiver's elements as the argument. Collect the resulting values into a collection like the receiver. Answer @@ -24,53 +26,53 @@ BioBlastContainerNode >> collect: aBlock [ ^ self nodes collect: aBlock ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastContainerNode >> contents [ ^ self nodes ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastContainerNode >> first [ "Answer the first element of the receiver" ^ self nodes first ] -{ #category : #comparing } +{ #category : 'comparing' } BioBlastContainerNode >> hash [ "hash is implemented because #= is implemented" ^ super hash bitXor: self nodes hash ] -{ #category : #testing } +{ #category : 'testing' } BioBlastContainerNode >> isEmpty [ "Answer whether the receiver contains any elements." ^ self nodes isEmpty ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastContainerNode >> last [ "Answer the last element of the receiver" ^ self nodes last ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastContainerNode >> nodes [ ^ nodes ifNil: [ nodes := OrderedCollection new ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastContainerNode >> nodes: anObject [ nodes := anObject ] -{ #category : #printing } +{ #category : 'printing' } BioBlastContainerNode >> printOn: aStream [ " Private - See superimplementor's comment " @@ -79,14 +81,14 @@ BioBlastContainerNode >> printOn: aStream [ ifNotNil: [ aStream nextPutAll: self nodes size asString between: $( and: $) ]. ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastContainerNode >> size [ "Answer how many elements the receiver contains." ^ self nodes size ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastContainerNode >> values: aNodeName [ " Answer a Collection of receiver's align lengths nodes in each HSP node " diff --git a/repository/BioParsers/BioBlastHitNode.class.st b/repository/BioParsers/BioBlastHitNode.class.st index 201188ed..ab950f79 100644 --- a/repository/BioParsers/BioBlastHitNode.class.st +++ b/repository/BioParsers/BioBlastHitNode.class.st @@ -1,36 +1,38 @@ Class { - #name : #BioBlastHitNode, - #superclass : #BioBlastValueNode, - #category : 'BioParsers-Support' + #name : 'BioBlastHitNode', + #superclass : 'BioBlastValueNode', + #category : 'BioParsers-Support', + #package : 'BioParsers', + #tag : 'Support' } -{ #category : #accessing } +{ #category : 'accessing' } BioBlastHitNode class >> description [ " See superimplementor's comment " ^ 'Serves as container of each HIT information' ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastHitNode class >> nodeDescriptions [ ^ #('Accession of the database sequence (e.g., "AAF57408")' 'Length of the database sequence' 'Ordinal number of the hit, with one-offset (e.g., "1, 2...")' 'Identifier of the database sequence (e.g., "gi|7297267|gb|AAF52530.1|")' 'Definition line of the database sequence (e.g., "(AE003618) CG6717 gene...")') ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastHitNode class >> nodeName [ " See superimplementor's comment " ^ 'Hit' ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastHitNode class >> nodeNames [ ^ #('Hit_accession' 'Hit_len' 'Hit_num' 'Hit_id' 'Hit_def') ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastHitNode >> addToParent: aNode [ aNode addHitNode: self diff --git a/repository/BioParsers/BioBlastHspNode.class.st b/repository/BioParsers/BioBlastHspNode.class.st index 7df12634..c3227770 100644 --- a/repository/BioParsers/BioBlastHspNode.class.st +++ b/repository/BioParsers/BioBlastHspNode.class.st @@ -1,36 +1,38 @@ Class { - #name : #BioBlastHspNode, - #superclass : #BioBlastValueNode, - #category : 'BioParsers-Support' + #name : 'BioBlastHspNode', + #superclass : 'BioBlastValueNode', + #category : 'BioParsers-Support', + #package : 'BioParsers', + #tag : 'Support' } -{ #category : #accessing } +{ #category : 'accessing' } BioBlastHspNode class >> description [ " See superimplementor's comment " ^ 'Serves as container of each HSP information' ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastHspNode class >> nodeDescriptions [ ^ #('Offset of database sequence at the end of the alignment (one-offset)' 'Offset of query at the end of the alignment (one-offset)' 'Number of gaps in the alignment' 'Length of the alignment used' 'End of phi-blast pattern on the query (one-offset)' 'Formatting middle line as normally seen in BLAST report' 'Offset of database sequence at the start of the alignment (one-offset)' 'Ordinal number of the HSP, one-offset' 'Number of identities in the alignment' 'Frame of the database sequence if applicable' 'Expect value of the HSP' 'Alignment string for the query' 'Frame of the query if applicable' 'Offset of query at the start of the alignment (one-offset)' 'Score (in bits) of the HSP' 'Alignment string for the database' 'Number of positive (conservative) substitutions in the alignment' 'Score density' 'Start of phi-blast pattern on the query (one-offset)' '') ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastHspNode class >> nodeName [ " See superimplementor's comment " ^ 'Hsp' ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastHspNode class >> nodeNames [ ^ #('Hsp_hit-to' 'Hsp_query-to' 'Hsp_gaps' 'Hsp_align-len' 'Hsp_pattern-to' 'Hsp_midline' 'Hsp_hit-from' 'Hsp_num' 'Hsp_identity' 'Hsp_hit-frame' 'Hsp_evalue' 'Hsp_qseq' 'Hsp_query-frame' 'Hsp_query-from' 'Hsp_score' 'Hsp_hseq' 'Hsp_positive' 'Hsp_density' 'Hsp_pattern-from' 'Hsp_bit-score') ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastHspNode >> addToParent: aNode [ aNode addHspNode: self diff --git a/repository/BioParsers/BioBlastNode.class.st b/repository/BioParsers/BioBlastNode.class.st index ab54aebf..9552a827 100644 --- a/repository/BioParsers/BioBlastNode.class.st +++ b/repository/BioParsers/BioBlastNode.class.st @@ -7,21 +7,23 @@ Instance Variables: nodeName " Class { - #name : #BioBlastNode, - #superclass : #BioObject, + #name : 'BioBlastNode', + #superclass : 'BioObject', #instVars : [ 'nodeName' ], - #category : #'BioParsers-Support' + #category : 'BioParsers-Support', + #package : 'BioParsers', + #tag : 'Support' } -{ #category : #accessing } +{ #category : 'accessing' } BioBlastNode class >> allContentSubclasses [ ^ self allSubclasses difference: ( Array with: BioBlastStructureNode ) ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastNode class >> allNodeNames [ " Answer a Collection with all the BLAST XML node names " @@ -29,7 +31,7 @@ BioBlastNode class >> allNodeNames [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastNode class >> allNodeWithDescriptions [ " Answer a Collection with all the BLAST XML node names with descriptions " @@ -43,7 +45,7 @@ BioBlastNode class >> allNodeWithDescriptions [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastNode class >> findElementNodeFor: aString [ " Answer an element node instance matching aString " @@ -53,7 +55,7 @@ BioBlastNode class >> findElementNodeFor: aString [ ifNone: [ nil ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastNode class >> nodeFor: aString [ " Answer a new instance of a subclass corresponding to element named aString " @@ -62,13 +64,13 @@ BioBlastNode class >> nodeFor: aString [ ifFalse: [ self findElementNodeFor: aString ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastNode class >> nodeNames [ ^ Array empty ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastNode class >> nodesWithDescriptions [ " Answer a of receiver nodes with corresponding description " @@ -81,14 +83,14 @@ BioBlastNode class >> nodesWithDescriptions [ ^ answer ] -{ #category : #comparing } +{ #category : 'comparing' } BioBlastNode >> = aBioBlastNode [ ^ self nodeName = aBioBlastNode nodeName ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastNode >> addToRoot: aRootNode [ " Private - Add the receiver to aRootNode " @@ -97,7 +99,7 @@ BioBlastNode >> addToRoot: aRootNode [ ifFalse: [ aRootNode addNode: self ] ] -{ #category : #'accessing nodes' } +{ #category : 'accessing nodes' } BioBlastNode >> do: aBlock [ " Answer a Collection of receiver's nodes named aNodeName " @@ -105,24 +107,24 @@ BioBlastNode >> do: aBlock [ ] -{ #category : #testing } +{ #category : 'testing' } BioBlastNode >> hasNodeNamed: aNodeName [ ^ self nodes anySatisfy: [ :node | node nodeName = aNodeName ] ] -{ #category : #comparing } +{ #category : 'comparing' } BioBlastNode >> hash [ ^ self nodeName hash ] -{ #category : #testing } +{ #category : 'testing' } BioBlastNode >> isParentNode [ ^ false ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastNode >> isRootIn: aRootNode [ " Answer if receiver's is used as 'top' element in the aRootNode nodes. I.e. if the receiver is a 'hit' node and the @@ -132,30 +134,30 @@ BioBlastNode >> isRootIn: aRootNode [ ] -{ #category : #testing } +{ #category : 'testing' } BioBlastNode >> isStructureNode [ ^ false ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastNode >> nodeName [ ^ nodeName ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastNode >> nodeName: anObject [ nodeName := anObject ] -{ #category : #testing } +{ #category : 'testing' } BioBlastNode >> notEmpty [ "Answer whether the receiver contains any elements." ^ self nodes notEmpty. ] -{ #category : #printing } +{ #category : 'printing' } BioBlastNode >> printOn: aStream [ " Private - See superimplementor's comment " @@ -164,7 +166,7 @@ BioBlastNode >> printOn: aStream [ nextPutAll: self nodeName asString between: $[ and: $] ] -{ #category : #'accessing nodes' } +{ #category : 'accessing nodes' } BioBlastNode >> selectNodeNamed: aNodeName [ " Answer the node named aNodeName " @@ -174,7 +176,7 @@ BioBlastNode >> selectNodeNamed: aNodeName [ ] -{ #category : #'accessing nodes' } +{ #category : 'accessing nodes' } BioBlastNode >> selectNodesNamed: aNodeName [ " Answer a Collection of receiver's nodes named aNodeName " diff --git a/repository/BioParsers/BioBlastParentNode.class.st b/repository/BioParsers/BioBlastParentNode.class.st index 127814d2..95461e13 100644 --- a/repository/BioParsers/BioBlastParentNode.class.st +++ b/repository/BioParsers/BioBlastParentNode.class.st @@ -1,53 +1,55 @@ Class { - #name : #BioBlastParentNode, - #superclass : #BioBlastContainerNode, - #category : 'BioParsers-Support' + #name : 'BioBlastParentNode', + #superclass : 'BioBlastContainerNode', + #category : 'BioParsers-Support', + #package : 'BioParsers', + #tag : 'Support' } -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioBlastParentNode class >> new: nodes [ ^ self new initialize: nodes ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastParentNode class >> nodeDescriptions [ ^ #('' '' '' '' '' '' '' '' '' '' '') ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastParentNode class >> nodeNames [ ^ #('Hsp' 'Hit_hsps' 'Hit') ] -{ #category : #'accessing hit individually' } +{ #category : 'accessing hit individually' } BioBlastParentNode >> accessionId [ ^ BioParser parseAccession: self hitAccession blastValue ] -{ #category : #'accessing nodes' } +{ #category : 'accessing nodes' } BioBlastParentNode >> addHitNode: aGTBLASTHitNode [ self nodes add: aGTBLASTHitNode ] -{ #category : #'accessing nodes' } +{ #category : 'accessing nodes' } BioBlastParentNode >> addHspNode: aGTHspNode [ self lastHsp addNode: aGTHspNode ] -{ #category : #'accessing nodes' } +{ #category : 'accessing nodes' } BioBlastParentNode >> addNode: aNode [ " Add aNode to the receiver's nodes " self nodes add: aNode ] -{ #category : #'accessing nodes' } +{ #category : 'accessing nodes' } BioBlastParentNode >> addParentNode: aGTBLASTParentNode [ self nodes isEmpty @@ -58,20 +60,20 @@ BioBlastParentNode >> addParentNode: aGTBLASTParentNode [ ifFalse: [ self nodes add: aGTBLASTParentNode ] ] ] -{ #category : #'accessing nodes' } +{ #category : 'accessing nodes' } BioBlastParentNode >> addTo: aGTBLASTNodeCollection [ aGTBLASTNodeCollection addLast: self. ^ self hspsNode ] -{ #category : #'accessing nodes' } +{ #category : 'accessing nodes' } BioBlastParentNode >> addToParent: aNode [ aNode addParentNode: self ] -{ #category : #'accessing hit individually' } +{ #category : 'accessing hit individually' } BioBlastParentNode >> asAccessionString [ " Answer a of receiver's accession number from the accession node, for example: 'AAF52530.1' Note: The value from the accession node usually doesn't contain the accession version number " @@ -80,7 +82,7 @@ BioBlastParentNode >> asAccessionString [ ] -{ #category : #'accessing hit individually' } +{ #category : 'accessing hit individually' } BioBlastParentNode >> asAccessionToken [ " Answer a of receiver's accession number from the accession node, for example: 'AAF52530.1' Note: The value from the accession node usually doesn't contain the accession version number " @@ -89,14 +91,14 @@ BioBlastParentNode >> asAccessionToken [ ] -{ #category : #'accessing hsps' } +{ #category : 'accessing hsps' } BioBlastParentNode >> asGeneId [ " Answer a of gene identifiers " ^ BioParser tokenizeGi: self hitIdentifier blastValue ] -{ #category : #'accessing hit individually' } +{ #category : 'accessing hit individually' } BioBlastParentNode >> hitAccession [ " Answer a of receiver's accession number from the accession node, for example: 'AAF52530.1' Note: The value from the accession node usually doesn't contain the accession version number " @@ -105,7 +107,7 @@ BioBlastParentNode >> hitAccession [ ] -{ #category : #'accessing hits' } +{ #category : 'accessing hits' } BioBlastParentNode >> hitAccessions [ " Answer a of receiver's accession of the database sequence (e.g., 'AAF57408.1') Note: This method parses dhe accession number from the HIT identifier, not from the Hit_accession node " @@ -114,7 +116,7 @@ BioBlastParentNode >> hitAccessions [ ] -{ #category : #'accessing hits' } +{ #category : 'accessing hits' } BioBlastParentNode >> hitDefinition [ " Answer a Collection of receiver's definition lines of the database sequence " @@ -122,7 +124,7 @@ BioBlastParentNode >> hitDefinition [ ] -{ #category : #'accessing hits' } +{ #category : 'accessing hits' } BioBlastParentNode >> hitDefinitions [ " Answer a Collection of receiver's accession of the database sequence (e.g., 'AAF57408.1') Note: This method parses dhe accession number from the HIT identifier, not from the Hit_accession node " @@ -131,7 +133,7 @@ BioBlastParentNode >> hitDefinitions [ ] -{ #category : #'accessing hits' } +{ #category : 'accessing hits' } BioBlastParentNode >> hitHsps [ " " @@ -139,7 +141,7 @@ BioBlastParentNode >> hitHsps [ ] -{ #category : #'accessing hit individually' } +{ #category : 'accessing hit individually' } BioBlastParentNode >> hitIdentifier [ " Answer a String of receiver's identifier of the database sequence (e.g., 'gi|7297267|gb|AAF52530.1|') " @@ -147,7 +149,7 @@ BioBlastParentNode >> hitIdentifier [ ] -{ #category : #'accessing hits' } +{ #category : 'accessing hits' } BioBlastParentNode >> hitIdentifiers [ " Answer a Collection of receiver's identifier of the database sequence (e.g., 'gi|7297267|gb|AAF52530.1|') " @@ -155,7 +157,7 @@ BioBlastParentNode >> hitIdentifiers [ ] -{ #category : #'accessing hit individually' } +{ #category : 'accessing hit individually' } BioBlastParentNode >> hitLength [ " Answer the receiver's hit length " @@ -163,7 +165,7 @@ BioBlastParentNode >> hitLength [ ] -{ #category : #'accessing hits' } +{ #category : 'accessing hits' } BioBlastParentNode >> hitNumbers [ " Answer a Collection of receiver's ordinal number of the hit, with one-offset (e.g., '1, 2...') " @@ -171,7 +173,7 @@ BioBlastParentNode >> hitNumbers [ ] -{ #category : #'accessing hit individually' } +{ #category : 'accessing hit individually' } BioBlastParentNode >> hspAlignLength [ " Answer a of receiver's align length " @@ -179,7 +181,7 @@ BioBlastParentNode >> hspAlignLength [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspAlignLengths [ " Answer a Collection of receiver's align lengths nodes in each HSP node " @@ -187,7 +189,7 @@ BioBlastParentNode >> hspAlignLengths [ ] -{ #category : #'accessing hsps' } +{ #category : 'accessing hsps' } BioBlastParentNode >> hspAlignLengths: aBlock [ " Possibly deprecated " " Answer a Collection of hits satisfying conditions specified in aBlock for align lengths in each HSP node for each HIT " @@ -201,7 +203,7 @@ BioBlastParentNode >> hspAlignLengths: aBlock [ ^ hits ] -{ #category : #'accessing hit individually' } +{ #category : 'accessing hit individually' } BioBlastParentNode >> hspBitScore [ " Answer a Collection of receiver's scores (in bits) of the HSPs " @@ -209,7 +211,7 @@ BioBlastParentNode >> hspBitScore [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspBitScores [ " Answer a Collection of receiver's scores (in bits) of the HSPs " @@ -217,7 +219,7 @@ BioBlastParentNode >> hspBitScores [ ] -{ #category : #'accessing hit individually' } +{ #category : 'accessing hit individually' } BioBlastParentNode >> hspEValue [ " Answer a Number of receiver's expect value of the HSPs " @@ -225,7 +227,7 @@ BioBlastParentNode >> hspEValue [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspEValues [ " Answer a Collection of receiver's expect values of the HSPs " @@ -233,14 +235,14 @@ BioBlastParentNode >> hspEValues [ ] -{ #category : #'accessing hit individually' } +{ #category : 'accessing hit individually' } BioBlastParentNode >> hspGaps [ " Answer a of receiver's number of gaps in the alignment " ^ self selectNodesNamed: 'Hsp_gaps'. ] -{ #category : #'accessing hit individually' } +{ #category : 'accessing hit individually' } BioBlastParentNode >> hspHSeq [ " Answer a of receiver's alignment strings (for the database) nodes in each HSP node " @@ -248,7 +250,7 @@ BioBlastParentNode >> hspHSeq [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspHSeqs [ " Answer a Collection of receiver's alignment strings (for the database) nodes in each HSP node " @@ -256,7 +258,7 @@ BioBlastParentNode >> hspHSeqs [ ] -{ #category : #'accessing hit individually' } +{ #category : 'accessing hit individually' } BioBlastParentNode >> hspHitFrame [ " Answer a of receiver's number of frames of the database sequence if applicable " @@ -264,7 +266,7 @@ BioBlastParentNode >> hspHitFrame [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspHitFrames [ " Answer a Collection of receiver's number of frames of the database sequence if applicable " @@ -272,7 +274,7 @@ BioBlastParentNode >> hspHitFrames [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspHitFrom [ " Answer a of receiver's offset of sequence at the start of the alignment (one-offset) " @@ -280,7 +282,7 @@ BioBlastParentNode >> hspHitFrom [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspHitScores [ " Answer a Collection of receiver's expect values of the HSPs " @@ -288,7 +290,7 @@ BioBlastParentNode >> hspHitScores [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspHitTo [ " Answer a of receiver's offsets of sequence at the end of the alignment (one-offset) " @@ -296,7 +298,7 @@ BioBlastParentNode >> hspHitTo [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspHitTos [ " - " @@ -304,7 +306,7 @@ BioBlastParentNode >> hspHitTos [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspIdentities [ " Answer a Collection of receiver's number of identities in the alignment " @@ -312,7 +314,7 @@ BioBlastParentNode >> hspIdentities [ ] -{ #category : #'accessing hit individually' } +{ #category : 'accessing hit individually' } BioBlastParentNode >> hspIdentity [ " Answer a of receiver's number of identities in the alignment " @@ -320,7 +322,7 @@ BioBlastParentNode >> hspIdentity [ ] -{ #category : #'accessing hit individually' } +{ #category : 'accessing hit individually' } BioBlastParentNode >> hspMidLine [ " Answer a of receiver's formatting middle line as normally seen in BLAST report " @@ -328,7 +330,7 @@ BioBlastParentNode >> hspMidLine [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspMidLines [ " Answer a Collection of receiver's formatting middle lines as normally seen in BLAST report " @@ -336,7 +338,7 @@ BioBlastParentNode >> hspMidLines [ ] -{ #category : #'accessing hit individually' } +{ #category : 'accessing hit individually' } BioBlastParentNode >> hspPositive [ " Answer a of receiver's number of positive (conservative) substitutions in the alignment " @@ -344,7 +346,7 @@ BioBlastParentNode >> hspPositive [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspPositives [ " Answer a Collection of receiver's number of positive (conservative) substitutions in the alignment " @@ -352,7 +354,7 @@ BioBlastParentNode >> hspPositives [ ] -{ #category : #'accessing hit individually' } +{ #category : 'accessing hit individually' } BioBlastParentNode >> hspQSeq [ " Answer a of receiver's alignment strings (for the query, this is the originally sent by the Blast user) " @@ -360,7 +362,7 @@ BioBlastParentNode >> hspQSeq [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspQSeqs [ " Answer a Collection of receiver's alignment strings (for the query, this is the originally sent by the Blast user) " @@ -368,7 +370,7 @@ BioBlastParentNode >> hspQSeqs [ ] -{ #category : #'accessing hit individually' } +{ #category : 'accessing hit individually' } BioBlastParentNode >> hspQueryFrame [ " Answer a of receiver's frame of the query if applicable " @@ -376,7 +378,7 @@ BioBlastParentNode >> hspQueryFrame [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspQueryFrames [ " Answer a of receiver's frames of the query if applicable " @@ -384,7 +386,7 @@ BioBlastParentNode >> hspQueryFrames [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspQueryFrom [ " Answer a of receiver's offsets of query at the start of the alignment (one-offset) " @@ -392,7 +394,7 @@ BioBlastParentNode >> hspQueryFrom [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspQueryFroms [ " Answer the start of HSP in query" @@ -400,7 +402,7 @@ BioBlastParentNode >> hspQueryFroms [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspQueryTo [ " Answer a of receiver's offset of query at the end of the alignment (one-offset) " @@ -408,7 +410,7 @@ BioBlastParentNode >> hspQueryTo [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspQueryTos [ " - " @@ -416,7 +418,7 @@ BioBlastParentNode >> hspQueryTos [ ] -{ #category : #'accessing hit individually' } +{ #category : 'accessing hit individually' } BioBlastParentNode >> hspScore [ " Answer a Collection of receiver's scores of the HSP " @@ -424,7 +426,7 @@ BioBlastParentNode >> hspScore [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspScoreDensity [ " Answer a Collection of receiver's scores of the HSP " @@ -432,7 +434,7 @@ BioBlastParentNode >> hspScoreDensity [ ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspScores [ " Answer a of receiver's scores of the HSP " @@ -440,20 +442,20 @@ BioBlastParentNode >> hspScores [ ] -{ #category : #'accessing hsps' } +{ #category : 'accessing hsps' } BioBlastParentNode >> hspsDo: aBlock [ self hspsNodes do: [: node | aBlock value: node ] ] -{ #category : #'filtering - hsps' } +{ #category : 'filtering - hsps' } BioBlastParentNode >> hspsGaps [ " Answer a Collection of receiver's number of gaps in the alignment " ^ self selectNodesNamed: 'Hsp_gaps'. ] -{ #category : #'accessing hsps' } +{ #category : 'accessing hsps' } BioBlastParentNode >> hspsNode [ ^ self nodes @@ -461,40 +463,40 @@ BioBlastParentNode >> hspsNode [ ifNone: [ self nodes add: ( self nodeFor: 'Hit_hsps' ) ] ] -{ #category : #'accessing hsps' } +{ #category : 'accessing hsps' } BioBlastParentNode >> hspsNodes [ ^ self nodes select: [: node | node nodeName = 'Hit_hsps' ] ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioBlastParentNode >> initialize: numberOfNodes [ " Private - Initialize the receiver's nodes " nodes := OrderedCollection new: numberOfNodes ] -{ #category : #testing } +{ #category : 'testing' } BioBlastParentNode >> isHitNode [ " Answer if receiver's type is a HIT node " ^ self nodeName = 'Hit' ] -{ #category : #testing } +{ #category : 'testing' } BioBlastParentNode >> isParentNode [ ^ true ] -{ #category : #'accessing hsps' } +{ #category : 'accessing hsps' } BioBlastParentNode >> lastHsp [ ^ self hspsNode lastHspNode ] -{ #category : #'accessing hsps' } +{ #category : 'accessing hsps' } BioBlastParentNode >> lastHspNode [ ^ self nodes reversed @@ -502,14 +504,14 @@ BioBlastParentNode >> lastHspNode [ ifNone: [ self nodes add: ( self nodeFor: 'Hsp' ) ] ] -{ #category : #'accessing nodes' } +{ #category : 'accessing nodes' } BioBlastParentNode >> nodeFor: aNodeName [ " Answer a new node setting the element name to aNodeName " ^ BioBlastNode nodeFor: aNodeName ] -{ #category : #'accessing hsps' } +{ #category : 'accessing hsps' } BioBlastParentNode >> percentageOverAlignment [ ^ self nodes collect: [: node | @@ -520,28 +522,28 @@ BioBlastParentNode >> percentageOverAlignment [ ] -{ #category : #'accessing hsps' } +{ #category : 'accessing hsps' } BioBlastParentNode >> selectAccessionNumber [ " Answer a BioAccession object " ^ self selectAccessionNumbers first ] -{ #category : #'accessing hsps' } +{ #category : 'accessing hsps' } BioBlastParentNode >> selectAccessionNumbers [ " Answer a of accession numbers " ^ (self hitIdentifiers collect: #blastValue) collect: [: defString | BioParser parseAccession: defString ] ] -{ #category : #'accessing hsps' } +{ #category : 'accessing hsps' } BioBlastParentNode >> selectGeneIdentifiers [ " Answer a of gene identifiers " ^ (self hitIdentifiers collect: #blastValue) collect: [: defString | BioParser tokenizeGi: defString ] ] -{ #category : #'extracting - hsps' } +{ #category : 'extracting - hsps' } BioBlastParentNode >> selectHitScore [ " Private - Handle the case for multiple HSPs. If there are multiple HSPs, this will answer a Number with the one with the highest alignment. " @@ -551,7 +553,7 @@ BioBlastParentNode >> selectHitScore [ ifTrue: [ (self hspHitScores detectMax: [: e | e blastValue asNumber ]) blastValue asNumber ] ] -{ #category : #'extracting - hsps' } +{ #category : 'extracting - hsps' } BioBlastParentNode >> selectHspAlign [ " Private - Handle the case for multiple HSPs. If there are multiple HSPs, this will answer a Number with the one with the highest alignment. " @@ -561,7 +563,7 @@ BioBlastParentNode >> selectHspAlign [ ifTrue: [ ( self hspAlignLengths detectMax: [: align | align blastValue asNumber ] ) blastValue asNumber ] ] -{ #category : #'accessing hsps' } +{ #category : 'accessing hsps' } BioBlastParentNode >> selectHspAlignLengths [ " Private - Handle the case for multiple HSPs. If there are multiple HSPs, this will answer a Number with the one with the highest alignment. " @@ -569,7 +571,7 @@ BioBlastParentNode >> selectHspAlignLengths [ ^ self hspAlignLengths collect: #blastValue ] -{ #category : #'extracting - hsps' } +{ #category : 'extracting - hsps' } BioBlastParentNode >> selectHspBitScores [ " Private - Handle the case for multiple HSPs. If there are multiple HSPs, this will answer a Number with the one with the highest alignment. " @@ -579,7 +581,7 @@ BioBlastParentNode >> selectHspBitScores [ ifTrue: [ (self hspBitScores detectMax: [: e | e blastValue asNumber ]) blastValue asNumber ] ] -{ #category : #'extracting - hsps' } +{ #category : 'extracting - hsps' } BioBlastParentNode >> selectHspEValue [ " Private - Handle the case for multiple HSPs. If there are multiple HSPs, this will answer a Number with the one with the highest alignment. " @@ -589,7 +591,7 @@ BioBlastParentNode >> selectHspEValue [ ifTrue: [ (self hspEValues detectMax: [: e | e blastValue asNumber ]) blastValue asNumber ] ] -{ #category : #'extracting - hsps' } +{ #category : 'extracting - hsps' } BioBlastParentNode >> selectHspHSeq [ " Private - Handle the case for multiple HSPs. If there are multiple HSPs, this will answer a Number with the one with the highest alignment. " @@ -600,7 +602,7 @@ BioBlastParentNode >> selectHspHSeq [ ] -{ #category : #'accessing hsps' } +{ #category : 'accessing hsps' } BioBlastParentNode >> selectHspHSeqs [ " Private - Handle the case for multiple HSPs. If there are multiple HSPs, this will answer a Number with the one with the highest alignment. " @@ -609,7 +611,7 @@ BioBlastParentNode >> selectHspHSeqs [ ] -{ #category : #'extracting - hsps' } +{ #category : 'extracting - hsps' } BioBlastParentNode >> selectHspHitFrom [ " Private - Handle the case for multiple HSPs. If there are multiple HSPs, this will answer a Number with the one with the highest alignment. " @@ -619,7 +621,7 @@ BioBlastParentNode >> selectHspHitFrom [ ifTrue: [ (self hspHitFrom detectMax: [: hspHitFrom | hspHitFrom blastValue ]) blastValue ] ] -{ #category : #'extracting - hsps' } +{ #category : 'extracting - hsps' } BioBlastParentNode >> selectHspHitTo [ " - " @@ -630,7 +632,7 @@ BioBlastParentNode >> selectHspHitTo [ ] -{ #category : #'extracting - hsps' } +{ #category : 'extracting - hsps' } BioBlastParentNode >> selectHspIdentity [ " Private - Handle the case for multiple HSPs. If there are multiple HSPs, this will answer a Number with the one with the highest alignment. " @@ -640,7 +642,7 @@ BioBlastParentNode >> selectHspIdentity [ ifTrue: [ ( self hspIdentities detectMax: [: id | id blastValue asNumber ] ) blastValue asNumber ] ] -{ #category : #'extracting - hsps' } +{ #category : 'extracting - hsps' } BioBlastParentNode >> selectHspMidLine [ " Private - Handle the case for multiple HSPs. If there are multiple HSPs, this will answer a Number with the one with the highest alignment. " @@ -650,7 +652,7 @@ BioBlastParentNode >> selectHspMidLine [ ifTrue: [ ( self hspMidLines detectMax: [: hspMidLine | hspMidLine blastValue size ] ) blastValue ] ] -{ #category : #'extracting - hsps' } +{ #category : 'extracting - hsps' } BioBlastParentNode >> selectHspNumberOfGaps [ " Private - Handle the case for multiple HSPs. If there are multiple HSPs, this will answer a Number with the one with the highest alignment. " @@ -664,7 +666,7 @@ BioBlastParentNode >> selectHspNumberOfGaps [ ifTrue: [ (gaps detectMax: [: hspGaps | hspGaps blastValue ]) blastValue ] ] -{ #category : #'extracting - hsps' } +{ #category : 'extracting - hsps' } BioBlastParentNode >> selectHspPositive [ " Private - Handle the case for multiple HSPs. If there are multiple HSPs, this will answer the one with the highest percent alignment. " @@ -674,7 +676,7 @@ BioBlastParentNode >> selectHspPositive [ ifTrue: [ ( self hspPositives detectMax: [: positive | positive blastValue asNumber ] ) blastValue asNumber ] ] -{ #category : #'extracting - hsps' } +{ #category : 'extracting - hsps' } BioBlastParentNode >> selectHspQSeq [ " Private - Handle the case for multiple HSPs. If there are multiple HSPs, this will answer a Number with the one with the highest alignment. " @@ -685,7 +687,7 @@ BioBlastParentNode >> selectHspQSeq [ ] -{ #category : #'extracting - hsps' } +{ #category : 'extracting - hsps' } BioBlastParentNode >> selectHspQueryFrom [ " Answer the start of HSP in query" @@ -695,7 +697,7 @@ BioBlastParentNode >> selectHspQueryFrom [ ] -{ #category : #'extracting - hsps' } +{ #category : 'extracting - hsps' } BioBlastParentNode >> selectHspQueryTo [ " - " @@ -705,7 +707,7 @@ BioBlastParentNode >> selectHspQueryTo [ ] -{ #category : #'extracting - hsps' } +{ #category : 'extracting - hsps' } BioBlastParentNode >> selectHspScore [ " Private - Handle the case for multiple HSPs. If there are multiple HSPs, this will answer a Number with the one with the highest alignment. " @@ -715,7 +717,7 @@ BioBlastParentNode >> selectHspScore [ ifTrue: [ (self hspScores detectMax: [: hspScore | hspScore blastValue asNumber ]) blastValue asNumber ] ] -{ #category : #'extracting - hsps' } +{ #category : 'extracting - hsps' } BioBlastParentNode >> selectHspScoreDensities [ " Private - Handle the case for multiple HSPs. If there are multiple HSPs, this will answer a Number with the one with the highest alignment. " @@ -729,7 +731,7 @@ BioBlastParentNode >> selectHspScoreDensities [ ifTrue: [ (score detectMax: [: hspScoreDensity | hspScoreDensity blastValue size ]) blastValue ] ] -{ #category : #'extracting - hsps' } +{ #category : 'extracting - hsps' } BioBlastParentNode >> selectIdentity [ " Private - Handle the case for multiple HSPs. If there are multiple HSPs, this will answer the one with the highest percent identity. " @@ -739,7 +741,7 @@ BioBlastParentNode >> selectIdentity [ ifTrue: [ ( self hspIdentities detectMax: [: ident | ident blastValue asNumber ] ) blastValue asNumber ] ] -{ #category : #'extracting - hsps' } +{ #category : 'extracting - hsps' } BioBlastParentNode >> selectPercentageOverAlignment [ ^ self percentageOverAlignment size > 1 diff --git a/repository/BioParsers/BioBlastRootNode.class.st b/repository/BioParsers/BioBlastRootNode.class.st index 187f3d89..753c43ac 100644 --- a/repository/BioParsers/BioBlastRootNode.class.st +++ b/repository/BioParsers/BioBlastRootNode.class.st @@ -1,23 +1,25 @@ Class { - #name : #BioBlastRootNode, - #superclass : #BioBlastParentNode, - #category : 'BioParsers-Support' + #name : 'BioBlastRootNode', + #superclass : 'BioBlastParentNode', + #category : 'BioParsers-Support', + #package : 'BioParsers', + #tag : 'Support' } -{ #category : #accessing } +{ #category : 'accessing' } BioBlastRootNode >> addNode: aNode [ aNode addToParent: self last ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastRootNode >> addRootNode: aNode [ " Add aNode to the receiver's nodes " self nodes add: aNode ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastRootNode >> hits [ " Answer the of hits in the receiver's nodes " diff --git a/repository/BioParsers/BioBlastStructureNode.class.st b/repository/BioParsers/BioBlastStructureNode.class.st index 364be05e..07089a34 100644 --- a/repository/BioParsers/BioBlastStructureNode.class.st +++ b/repository/BioParsers/BioBlastStructureNode.class.st @@ -2,32 +2,34 @@ The structure exists only to specify those nodes which are present in the XML and are part of the hits results tree. This way we can build the tree keeping the original structure of the XML results. " Class { - #name : #BioBlastStructureNode, - #superclass : #BioBlastContainerNode, - #category : 'BioParsers-Support' + #name : 'BioBlastStructureNode', + #superclass : 'BioBlastContainerNode', + #category : 'BioParsers-Support', + #package : 'BioParsers', + #tag : 'Support' } -{ #category : #accessing } +{ #category : 'accessing' } BioBlastStructureNode class >> nodeDescriptions [ ^ #('' '' '') ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastStructureNode class >> nodeNames [ " Answer a of all nodes used for structuring the blast tree " ^ #('Hsp' 'Hit_hsps' 'Hit' 'BlastOutput_param' 'Parameters' 'Iteration' 'Iteration_hits' 'Iteration' 'BlastOutput_iterations' 'BlastOutput' 'Iteration_stat' 'Statistics' 'BlastOutput_program' 'BlastOutput_version' 'BlastOutput_reference' 'BlastOutput_db' 'BlastOutput_query-ID' 'BlastOutput_query-def' 'BlastOutput_query-len' ) ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastStructureNode class >> nodes [ " Answer a of all nodes used for structuring the blast tree wihout the header nodes " ^ #('Hsp' 'Hit_hsps' 'Hit' 'Iteration' 'Iteration_hits' 'Iteration' 'BlastOutput_iterations' 'BlastOutput') ] -{ #category : #testing } +{ #category : 'testing' } BioBlastStructureNode >> isStructureNode [ ^ true diff --git a/repository/BioParsers/BioBlastValueNode.class.st b/repository/BioParsers/BioBlastValueNode.class.st index 39d458eb..974bd135 100644 --- a/repository/BioParsers/BioBlastValueNode.class.st +++ b/repository/BioParsers/BioBlastValueNode.class.st @@ -2,21 +2,23 @@ Abstract class to group common behavior of single value nodes in a BLAST tree " Class { - #name : #BioBlastValueNode, - #superclass : #BioBlastNode, + #name : 'BioBlastValueNode', + #superclass : 'BioBlastNode', #instVars : [ 'value' ], - #category : 'BioParsers-Support' + #category : 'BioParsers-Support', + #package : 'BioParsers', + #tag : 'Support' } -{ #category : #accessing } +{ #category : 'accessing' } BioBlastValueNode >> addToRoot: aGTBLASTRootNode [ " Do nothing " ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastValueNode >> blastValue [ " Answer the receiver's value " @@ -27,24 +29,24 @@ BioBlastValueNode >> blastValue [ ifFalse: [ value ] ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastValueNode >> blastValue: anObject [ value := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastValueNode >> do: aBlock [ ^ aBlock value: self ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastValueNode >> selectNodesNamed: aNodeName [ ^ OrderedCollection new ] -{ #category : #accessing } +{ #category : 'accessing' } BioBlastValueNode >> values: aNodeName [ " Answer the receiver's value if aNodeName is the receiver's name " diff --git a/repository/BioParsers/BioBrookhavenProtParser.class.st b/repository/BioParsers/BioBrookhavenProtParser.class.st index cc0ea4da..d4ce8b27 100644 --- a/repository/BioParsers/BioBrookhavenProtParser.class.st +++ b/repository/BioParsers/BioBrookhavenProtParser.class.st @@ -3,31 +3,33 @@ pdb|entry|chain " Class { - #name : #BioBrookhavenProtParser, - #superclass : #BioNCBIIdParser, - #category : #'BioParsers-Core' + #name : 'BioBrookhavenProtParser', + #superclass : 'BioNCBIIdParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #accessing } +{ #category : 'accessing' } BioBrookhavenProtParser class >> identifier [ " See superimplementor's comment " ^ 'pdb' ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioBrookhavenProtParser >> chain [ ^ self parserForNonFastaString ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioBrookhavenProtParser >> entry [ ^ self parserForNonFastaString ] -{ #category : #initialization } +{ #category : 'initialization' } BioBrookhavenProtParser >> initialize [ super initialize. diff --git a/repository/BioParsers/BioCompositeIDParser.class.st b/repository/BioParsers/BioCompositeIDParser.class.st index 8b9ea88c..41c50594 100644 --- a/repository/BioParsers/BioCompositeIDParser.class.st +++ b/repository/BioParsers/BioCompositeIDParser.class.st @@ -1,10 +1,12 @@ Class { - #name : #BioCompositeIDParser, - #superclass : #BioNCBIIdParser, - #category : 'BioParsers-Core' + #name : 'BioCompositeIDParser', + #superclass : 'BioNCBIIdParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioCompositeIDParser >> giParser [ " Answer a Parser for parsing the Gene Identifier part of a description line " @@ -12,7 +14,7 @@ BioCompositeIDParser >> giParser [ ^ BioGIParser new parser ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioCompositeIDParser >> initialize [ " Private - See superimplementor's comment " @@ -22,7 +24,7 @@ BioCompositeIDParser >> initialize [ self parserForDbAccessionLocus ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioCompositeIDParser >> parserForDbAccessionLocus [ ^ self parserForGenBank | diff --git a/repository/BioParsers/BioDDBJParser.class.st b/repository/BioParsers/BioDDBJParser.class.st index bc42a9ae..82d5c494 100644 --- a/repository/BioParsers/BioDDBJParser.class.st +++ b/repository/BioParsers/BioDDBJParser.class.st @@ -3,12 +3,14 @@ dbj|accession|locus " Class { - #name : #BioDDBJParser, - #superclass : #BioAbstractALParser, - #category : 'BioParsers-Core' + #name : 'BioDDBJParser', + #superclass : 'BioAbstractALParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #accessing } +{ #category : 'accessing' } BioDDBJParser class >> identifier [ " See superimplementor's comment " diff --git a/repository/BioParsers/BioEMBLParser.class.st b/repository/BioParsers/BioEMBLParser.class.st index f116eaac..6cc3ba98 100644 --- a/repository/BioParsers/BioEMBLParser.class.st +++ b/repository/BioParsers/BioEMBLParser.class.st @@ -3,19 +3,21 @@ emb|accession|ID " Class { - #name : #BioEMBLParser, - #superclass : #BioAbstractALParser, - #category : 'BioParsers-Core' + #name : 'BioEMBLParser', + #superclass : 'BioAbstractALParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #accessing } +{ #category : 'accessing' } BioEMBLParser class >> identifier [ " See superimplementor's comment " ^ 'emb' ] -{ #category : #accessing } +{ #category : 'accessing' } BioEMBLParser >> parseId: aString [ " Answer a String with the ID identifier in aString " diff --git a/repository/BioParsers/BioEResultKeysParser.class.st b/repository/BioParsers/BioEResultKeysParser.class.st index 93e7ac9e..1981ba08 100644 --- a/repository/BioParsers/BioEResultKeysParser.class.st +++ b/repository/BioParsers/BioEResultKeysParser.class.st @@ -3,25 +3,27 @@ Parser for extracting XML nodes returned by a Entrez Search result. See http://www.ncbi.nlm.nih.gov/books/NBK25500/ for details (15/11/2011) " Class { - #name : #BioEResultKeysParser, - #superclass : #BioEntrezResultParser, - #category : 'BioParsers-Core' + #name : 'BioEResultKeysParser', + #superclass : 'BioEntrezResultParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #content } +{ #category : 'content' } BioEResultKeysParser >> defaultNodes [ ^ #( 'eSearchResult' 'Count' 'RetMax' 'RetStart' 'QueryKey' 'WebEnv' 'IdList' 'TranslationSet' 'QueryTranslation') ] -{ #category : #private } +{ #category : 'private' } BioEResultKeysParser >> resultClass [ " Private - See superimplementor's comment " ^ Set ] -{ #category : #content } +{ #category : 'content' } BioEResultKeysParser >> startElement: elementName attributeList: attributeList [ " Private - See superimplementor's comment " @@ -29,7 +31,7 @@ BioEResultKeysParser >> startElement: elementName attributeList: attributeList [ ] -{ #category : #content } +{ #category : 'content' } BioEResultKeysParser >> startElement: elementName attributes: attributeList [ " Private - See superimplementor's comment " diff --git a/repository/BioParsers/BioEntrezResultParser.class.st b/repository/BioParsers/BioEntrezResultParser.class.st index 20b5d353..79ee9845 100644 --- a/repository/BioParsers/BioEntrezResultParser.class.st +++ b/repository/BioParsers/BioEntrezResultParser.class.st @@ -5,12 +5,14 @@ Instance Variables: current " Class { - #name : #BioEntrezResultParser, - #superclass : #BioSAXParser, - #category : 'BioParsers-Core' + #name : 'BioEntrezResultParser', + #superclass : 'BioSAXParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #content } +{ #category : 'content' } BioEntrezResultParser >> characters: aString [ " See superimplementor´s comment " @@ -20,21 +22,21 @@ BioEntrezResultParser >> characters: aString [ ] -{ #category : #private } +{ #category : 'private' } BioEntrezResultParser >> estimatedResultSize [ " Private - See superimplementor's comment " ^ 20 ] -{ #category : #private } +{ #category : 'private' } BioEntrezResultParser >> resultClass [ " Private - See superimplementor's comment " ^ OrderedCollection ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezResultParser >> startElement: elementName attributeList: attributeList [ " Private - See superimplementor's comment " @@ -44,7 +46,7 @@ BioEntrezResultParser >> startElement: elementName attributeList: attributeList ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezResultParser >> startElement: elementName attributes: attributeList [ " Private - See superimplementor's comment " diff --git a/repository/BioParsers/BioEntrezXMLGBBasicParser.class.st b/repository/BioParsers/BioEntrezXMLGBBasicParser.class.st index 98a9bd76..cd6b0ed2 100644 --- a/repository/BioParsers/BioEntrezXMLGBBasicParser.class.st +++ b/repository/BioParsers/BioEntrezXMLGBBasicParser.class.st @@ -2,12 +2,14 @@ This is a basic parser which can parse accession, definition and sequence nodes from each GBSeq. " Class { - #name : #BioEntrezXMLGBBasicParser, - #superclass : #BioEntrezXMLGenBankSeqParser, - #category : #'BioParsers-Core' + #name : 'BioEntrezXMLGBBasicParser', + #superclass : 'BioEntrezXMLGenBankSeqParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGBBasicParser class >> parserNodes [ " See superimplementor's comment " @@ -18,7 +20,7 @@ BioEntrezXMLGBBasicParser class >> parserNodes [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGBBasicParser >> defaultNodes [ " Add node names in your specific subclasses. Answer a Collection of Strings corresponding with the XML's DTD with the node names in which we are interested " @@ -26,7 +28,7 @@ BioEntrezXMLGBBasicParser >> defaultNodes [ ^ super defaultNodes , self parserNodes ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGBBasicParser >> endElement: elementName [ (super endElement: elementName) diff --git a/repository/BioParsers/BioEntrezXMLGBFullParser.class.st b/repository/BioParsers/BioEntrezXMLGBFullParser.class.st index 4cf2e9c9..3b7a7b45 100644 --- a/repository/BioParsers/BioEntrezXMLGBFullParser.class.st +++ b/repository/BioParsers/BioEntrezXMLGBFullParser.class.st @@ -1,24 +1,26 @@ Class { - #name : #BioEntrezXMLGBFullParser, - #superclass : #BioEntrezXMLGenBankSeqParser, - #category : #'BioParsers-Core' + #name : 'BioEntrezXMLGBFullParser', + #superclass : 'BioEntrezXMLGenBankSeqParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGBFullParser class >> parserNodes [ " See superimplementor's comment " ^ #('GBSeq_locus' 'GBSeq_length' 'GBSeq_strandedness' 'GBSeq_moltype' 'GBSeq_topology' 'GBSeq_division' 'GBSeq_update-date' 'GBSeq_definition' 'GBSeq_accession-version' 'GBSeq_source' 'GBSeq_organism' 'GBSeq_taxonomy' 'GBReference_position' 'GBReference_reference' 'GBSeq_sequence' 'GBAuthor' 'GBReference_title' 'GBReference_journal') ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGBFullParser >> defaultNodes [ " Add node names in your specific subclasses. Answer a Collection of Strings corresponding with the XML's DTD with the node names in which we are interested " ^ super defaultNodes , self parserNodes ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGBFullParser >> endElement: elementName [ (super endElement: elementName) diff --git a/repository/BioParsers/BioEntrezXMLGBSeqFeatureQualParser.class.st b/repository/BioParsers/BioEntrezXMLGBSeqFeatureQualParser.class.st index 545ca3b3..4a123255 100644 --- a/repository/BioParsers/BioEntrezXMLGBSeqFeatureQualParser.class.st +++ b/repository/BioParsers/BioEntrezXMLGBSeqFeatureQualParser.class.st @@ -36,12 +36,14 @@ fileRef := BioObject testFilesFullDirectoryName / 'GenBankTestFiles' / 'TestGBSe " Class { - #name : #BioEntrezXMLGBSeqFeatureQualParser, - #superclass : #BioEntrezXMLGBSeqParser, - #category : 'BioParsers-XML' + #name : 'BioEntrezXMLGBSeqFeatureQualParser', + #superclass : 'BioEntrezXMLGBSeqParser', + #category : 'BioParsers-XML', + #package : 'BioParsers', + #tag : 'XML' } -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGBSeqFeatureQualParser class >> defaultNodes [ ^ #( @@ -56,7 +58,7 @@ BioEntrezXMLGBSeqFeatureQualParser class >> defaultNodes [ 'GBQualifier_value' ) ] -{ #category : #private } +{ #category : 'private' } BioEntrezXMLGBSeqFeatureQualParser >> saveGBNode: result [ " Set qualifier name as key and qualifier value as value for a GenBank node. If result is not a feature qualifier, then belongs to a 'single tag' value, i.e. GBSeq_locus, GBSeq_length, etc., use the tag name as property key. diff --git a/repository/BioParsers/BioEntrezXMLGBSeqFullParser.class.st b/repository/BioParsers/BioEntrezXMLGBSeqFullParser.class.st index 04fe79f6..cce00f7f 100644 --- a/repository/BioParsers/BioEntrezXMLGBSeqFullParser.class.st +++ b/repository/BioParsers/BioEntrezXMLGBSeqFullParser.class.st @@ -1,10 +1,12 @@ Class { - #name : #BioEntrezXMLGBSeqFullParser, - #superclass : #BioEntrezXMLGBSeqParser, - #category : 'BioParsers-XML' + #name : 'BioEntrezXMLGBSeqFullParser', + #superclass : 'BioEntrezXMLGBSeqParser', + #category : 'BioParsers-XML', + #package : 'BioParsers', + #tag : 'XML' } -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGBSeqFullParser class >> defaultNodes [ ^ #( @@ -22,7 +24,7 @@ BioEntrezXMLGBSeqFullParser class >> defaultNodes [ 'GBQualifier_value' ) ] -{ #category : #private } +{ #category : 'private' } BioEntrezXMLGBSeqFullParser >> saveGBNode: result [ " Set qualifier name as key and qualifier value as value for a GenBank node. If result is not a feature qualifier, then belongs to a 'single tag' value, i.e. GBSeq_locus, GBSeq_length, etc., use the tag name as property key. diff --git a/repository/BioParsers/BioEntrezXMLGBSeqJournalParser.class.st b/repository/BioParsers/BioEntrezXMLGBSeqJournalParser.class.st index a2ebe6c5..d2b91438 100644 --- a/repository/BioParsers/BioEntrezXMLGBSeqJournalParser.class.st +++ b/repository/BioParsers/BioEntrezXMLGBSeqJournalParser.class.st @@ -6,12 +6,14 @@ fileRef := BioObject testFilesFullDirectoryName / 'GenBankTestFiles' / 'TestGBSe (BioEntrezXMLGBSeqJournalParser on: fileRef readStream) collectGBSet " Class { - #name : #BioEntrezXMLGBSeqJournalParser, - #superclass : #BioEntrezXMLGBSeqParser, - #category : 'BioParsers-XML' + #name : 'BioEntrezXMLGBSeqJournalParser', + #superclass : 'BioEntrezXMLGBSeqParser', + #category : 'BioParsers-XML', + #package : 'BioParsers', + #tag : 'XML' } -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGBSeqJournalParser class >> defaultNodes [ ^ { #qualifierForAccessionWithVersion . @@ -21,7 +23,7 @@ BioEntrezXMLGBSeqJournalParser class >> defaultNodes [ ] -{ #category : #private } +{ #category : 'private' } BioEntrezXMLGBSeqJournalParser >> newIdForKey: keyName [ " Answer a with the last ID number given keyName. I.e. given keys like ID, ID_1, ID_2, answer ID_3 " @@ -33,7 +35,7 @@ BioEntrezXMLGBSeqJournalParser >> newIdForKey: keyName [ ] -{ #category : #private } +{ #category : 'private' } BioEntrezXMLGBSeqJournalParser >> saveGBNode: collectionOfNodeAssociation [ | assoc | diff --git a/repository/BioParsers/BioEntrezXMLGBSeqParser.class.st b/repository/BioParsers/BioEntrezXMLGBSeqParser.class.st index 8ff9eab9..7049e35a 100644 --- a/repository/BioParsers/BioEntrezXMLGBSeqParser.class.st +++ b/repository/BioParsers/BioEntrezXMLGBSeqParser.class.st @@ -19,16 +19,18 @@ See http://www.ncbi.nlm.nih.gov/dtd/NCBI_GBSeq.mod.dtd for details " Class { - #name : #BioEntrezXMLGBSeqParser, - #superclass : #BioXMLParser, + #name : 'BioEntrezXMLGBSeqParser', + #superclass : 'BioXMLParser', #instVars : [ 'matches', 'records' ], - #category : #'BioParsers-XML' + #category : 'BioParsers-XML', + #package : 'BioParsers', + #tag : 'XML' } -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGBSeqParser >> collectGBSet [ " Parse the receiver expression and answer a of resulting nodes " @@ -43,44 +45,44 @@ BioEntrezXMLGBSeqParser >> collectGBSet [ ^ self results. ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGBSeqParser >> defaultFormatterClass [ ^ BioXMLOrderedCollection ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGBSeqParser >> defaultMatchesClass [ ^ Dictionary ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGBSeqParser >> matches [ ^ matches ifNil: [ matches := self defaultMatchesClass new ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGBSeqParser >> matches: anObject [ matches := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGBSeqParser >> parse [ " Parse the receiver expression and answer a of resulting nodes " ^ self collectGBSet ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGBSeqParser >> records [ ^ records ifNil: [ records := OrderedCollection new ] ] -{ #category : #private } +{ #category : 'private' } BioEntrezXMLGBSeqParser >> saveGBSeq [ self matches notEmpty ifFalse: [ ^ self ]. diff --git a/repository/BioParsers/BioEntrezXMLGenBankSeqParser.class.st b/repository/BioParsers/BioEntrezXMLGenBankSeqParser.class.st index 984e345f..3d67ed70 100644 --- a/repository/BioParsers/BioEntrezXMLGenBankSeqParser.class.st +++ b/repository/BioParsers/BioEntrezXMLGenBankSeqParser.class.st @@ -2,22 +2,24 @@ This parser checks nodes containing keyword ""GBSeq"". When found a new entrez record (eRecord) is added to the results Collection. If not found it means GBSeq is an element container, so record values are set in the current eRecord (#saveERecordValue:) " Class { - #name : #BioEntrezXMLGenBankSeqParser, - #superclass : #BioEntrezResultParser, + #name : 'BioEntrezXMLGenBankSeqParser', + #superclass : 'BioEntrezResultParser', #instVars : [ 'eRecord' ], - #category : #'BioParsers-Core' + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGenBankSeqParser >> characters: arg1 [ catchNodes ifTrue: [ self newERecordValue: arg1 ]. self catchOff ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGenBankSeqParser >> defaultNodes [ " Add node names in your specific subclasses. Answer a Collection of Strings corresponding with the XML's DTD with the node names in which we are interested " @@ -33,30 +35,30 @@ BioEntrezXMLGenBankSeqParser >> defaultNodes [ 'GBSeq_sequence' " ) ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGenBankSeqParser >> eRecord [ ^ eRecord ifNil: [ eRecord := self entrezRecordClass new ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGenBankSeqParser >> eRecord: anObject [ eRecord := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGenBankSeqParser >> endElement: elementName [ ^ elementName = 'GBSet' ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGenBankSeqParser >> entrezRecordClass [ ^ Dictionary ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGenBankSeqParser >> newERecordValue: aString [ " Private - Save current node with value aString in the receiver's current entrez record entry " @@ -69,7 +71,7 @@ BioEntrezXMLGenBankSeqParser >> newERecordValue: aString [ self eRecord: self entrezRecordClass new ] ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGenBankSeqParser >> saveERecordValue: aString [ " Private - Save current node with value aString in the receiver's current entrez record entry " diff --git a/repository/BioParsers/BioEntrezXMLGenSetParser.class.st b/repository/BioParsers/BioEntrezXMLGenSetParser.class.st index f1b06ffd..fae3eb23 100644 --- a/repository/BioParsers/BioEntrezXMLGenSetParser.class.st +++ b/repository/BioParsers/BioEntrezXMLGenSetParser.class.st @@ -1,13 +1,15 @@ Class { - #name : #BioEntrezXMLGenSetParser, - #superclass : #BioEntrezResultParser, + #name : 'BioEntrezXMLGenSetParser', + #superclass : 'BioEntrezResultParser', #instVars : [ 'eRecord' ], - #category : 'BioParsers-Core' + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGenSetParser >> characters: aString [ " See superimplementor´s comment " @@ -21,7 +23,7 @@ BioEntrezXMLGenSetParser >> characters: aString [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGenSetParser >> defaultNodes [ " Add node names in your specific subclasses. Answer a Collection of Strings corresponding with the XML's DTD with the node names in which we are interested " @@ -34,24 +36,24 @@ BioEntrezXMLGenSetParser >> defaultNodes [ 'Seq-interval_to' ) ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGenSetParser >> eRecord [ ^ eRecord ifNil: [ eRecord := Dictionary new ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGenSetParser >> eRecord: anObject [ eRecord := anObject ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGenSetParser >> endElement: elementName [ ^ elementName = 'Entrezgene' ] -{ #category : #accessing } +{ #category : 'accessing' } BioEntrezXMLGenSetParser >> saveERecordValue: aString [ self eRecord at: current put: aString diff --git a/repository/BioParsers/BioFASTABasicParser.class.st b/repository/BioParsers/BioFASTABasicParser.class.st index d44f620b..8f6136dc 100644 --- a/repository/BioParsers/BioFASTABasicParser.class.st +++ b/repository/BioParsers/BioFASTABasicParser.class.st @@ -2,12 +2,14 @@ This class is not intended to be used directly " Class { - #name : #BioFASTABasicParser, - #superclass : #BioIDParser, - #category : #'BioParsers-Core' + #name : 'BioFASTABasicParser', + #superclass : 'BioIDParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #'accessing private' } +{ #category : 'accessing private' } BioFASTABasicParser >> buildFastaRecord: aCollection [ ^ BioFastaRecord @@ -15,7 +17,7 @@ BioFASTABasicParser >> buildFastaRecord: aCollection [ sequence: (self seqFrom: aCollection last) ] -{ #category : #'accessing private' } +{ #category : 'accessing private' } BioFASTABasicParser >> buildResults: aCollection [ " Answer an identified object for the receiver's parsing output " @@ -24,7 +26,7 @@ BioFASTABasicParser >> buildResults: aCollection [ ifFalse: [ aCollection collect: [ : seq | self buildResults: seq ] ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioFASTABasicParser >> buildTokens: aCollection [ " Answer an identified object for the receiver's parsing output " @@ -37,7 +39,7 @@ BioFASTABasicParser >> buildTokens: aCollection [ ^ self results ] -{ #category : #initialization } +{ #category : 'initialization' } BioFASTABasicParser >> fastaParser [ ^ ( @@ -53,7 +55,7 @@ BioFASTABasicParser >> fastaParser [ ) plus ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioFASTABasicParser >> initializeWith: aString [ " Private - See superimplementor's comment " @@ -62,25 +64,25 @@ BioFASTABasicParser >> initializeWith: aString [ ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioFASTABasicParser >> newLineParser [ ^ #newline asPParser ] -{ #category : #initialization } +{ #category : 'initialization' } BioFASTABasicParser >> removeNewLinesAndJoinBlock [ ^ [ : nodes | (nodes reject: [ : line | line = Character cr asString or: [ line = Character lf asString ]]) joinUsing: '' ] ] -{ #category : #removing } +{ #category : 'removing' } BioFASTABasicParser >> removeNewlinesBlock [ ^ [ :nodes | nodes copyWithoutAll: { Character cr asString . Character lf asString } ] ] -{ #category : #'accessing private' } +{ #category : 'accessing private' } BioFASTABasicParser >> seqFrom: aCollection [ " Answer a new sequence object from aCollection using the receiver's alphabet class " @@ -89,20 +91,20 @@ BioFASTABasicParser >> seqFrom: aCollection [ alphabet: self alphabetClass ] -{ #category : #'accessing private' } +{ #category : 'accessing private' } BioFASTABasicParser >> sequenceClass [ " Answer a used to represent biological sequences " ^ BioSequence ] -{ #category : #'accessing private' } +{ #category : 'accessing private' } BioFASTABasicParser >> sequenceCollectionFrom: aCollection [ ^ aCollection copy ] -{ #category : #'accessing-public' } +{ #category : 'accessing-public' } BioFASTABasicParser >> sequenceInfo [ " Answer a with the receiver's parsed information or description found in the header " @@ -110,7 +112,7 @@ BioFASTABasicParser >> sequenceInfo [ ^ self results sequenceName ] -{ #category : #accessing } +{ #category : 'accessing' } BioFASTABasicParser >> tokenize [ " Private - Answer a String with the receiver's expression tokenized " diff --git a/repository/BioParsers/BioFASTAMultiParser.class.st b/repository/BioParsers/BioFASTAMultiParser.class.st index e2f2bd67..fbb37e1d 100644 --- a/repository/BioParsers/BioFASTAMultiParser.class.st +++ b/repository/BioParsers/BioFASTAMultiParser.class.st @@ -2,12 +2,14 @@ Parser for a FASTA file with several sequences. This class is not intended to be used directly. See BioParser for details parsing FASTA files. " Class { - #name : #BioFASTAMultiParser, - #superclass : #BioFASTABasicParser, - #category : #'BioParsers-Core' + #name : 'BioFASTAMultiParser', + #superclass : 'BioFASTABasicParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #'accessing private' } +{ #category : 'accessing private' } BioFASTAMultiParser >> buildResults: aCollection [ " Answer an identified object for the receiver's parsing output " @@ -20,7 +22,7 @@ BioFASTAMultiParser >> buildResults: aCollection [ ^ self results ] -{ #category : #'accessing private' } +{ #category : 'accessing private' } BioFASTAMultiParser >> parseResultClass [ " Answer the class used for maintaining succesfully parse results " diff --git a/repository/BioParsers/BioFASTAParser.class.st b/repository/BioParsers/BioFASTAParser.class.st index dd6f3a16..99760cbc 100644 --- a/repository/BioParsers/BioFASTAParser.class.st +++ b/repository/BioParsers/BioFASTAParser.class.st @@ -2,12 +2,14 @@ Parser for several FASTA file format elements. This class is not intended to be used directly. See BioParser for details parsing FASTA files. " Class { - #name : #BioFASTAParser, - #superclass : #BioAbstractTextParser, - #category : #'BioParsers-Core' + #name : 'BioFASTAParser', + #superclass : 'BioAbstractTextParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioFASTAParser >> parserForAnyDescriptionLine [ | separator token | @@ -18,14 +20,14 @@ BioFASTAParser >> parserForAnyDescriptionLine [ ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioFASTAParser >> parserForAnyDescriptionText [ ^ self parserForAnyDescriptionLine ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioFASTAParser >> parserForDescriptionLine [ ^ $> asPParser , @@ -35,13 +37,13 @@ BioFASTAParser >> parserForDescriptionLine [ ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioFASTAParser >> parserForDescriptionString [ ^ self parserForDescriptionLine ==> #second ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioFASTAParser >> parserForIdentifier [ " Answer a parser for parsing an identifier in a FASTA entry " @@ -49,14 +51,14 @@ BioFASTAParser >> parserForIdentifier [ ^ self identifier asPParser ==> [: r | (r last = $|) ifTrue: [ r allButLast ] ifFalse: [ r ] ] ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioFASTAParser >> parserForNonFastaString [ " Answer a parser for parsing any kind of description text in a FASTA sequence " ^ self noneOf: self specialFastaChars ] -{ #category : #'accessing private' } +{ #category : 'accessing private' } BioFASTAParser >> specialFastaChars [ " Answer a Collection with Characters with special meaning for the FASTA definition line format " @@ -66,7 +68,7 @@ BioFASTAParser >> specialFastaChars [ with: $| ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioFASTAParser >> tokenizeDescriptionLine [ | separator token | @@ -77,7 +79,7 @@ BioFASTAParser >> tokenizeDescriptionLine [ ^ self parse: self expression ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioFASTAParser >> tokenizeDescriptionText [ ^ self tokenizeDescriptionLine last diff --git a/repository/BioParsers/BioFastaRecord.extension.st b/repository/BioParsers/BioFastaRecord.extension.st index 89b46c89..bd23ff83 100644 --- a/repository/BioParsers/BioFastaRecord.extension.st +++ b/repository/BioParsers/BioFastaRecord.extension.st @@ -1,6 +1,6 @@ -Extension { #name : #BioFastaRecord } +Extension { #name : 'BioFastaRecord' } -{ #category : #'*BioParsers' } +{ #category : '*BioParsers' } BioFastaRecord >> sequenceDescription [ " Answer a with the receiver's sequence description " diff --git a/repository/BioParsers/BioFlatGenBankParser.class.st b/repository/BioParsers/BioFlatGenBankParser.class.st index c4dba928..2aa3111e 100644 --- a/repository/BioParsers/BioFlatGenBankParser.class.st +++ b/repository/BioParsers/BioFlatGenBankParser.class.st @@ -4,7 +4,9 @@ Work in progress " Class { - #name : #BioFlatGenBankParser, - #superclass : #BioAbstractTextParser, - #category : 'BioParsers-Core' + #name : 'BioFlatGenBankParser', + #superclass : 'BioAbstractTextParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } diff --git a/repository/BioParsers/BioGBParser.class.st b/repository/BioParsers/BioGBParser.class.st index 6ebf5093..71e30a75 100644 --- a/repository/BioParsers/BioGBParser.class.st +++ b/repository/BioParsers/BioGBParser.class.st @@ -3,19 +3,21 @@ gb|accession|locus " Class { - #name : #BioGBParser, - #superclass : #BioAbstractALParser, - #category : #'BioParsers-Core' + #name : 'BioGBParser', + #superclass : 'BioAbstractALParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #accessing } +{ #category : 'accessing' } BioGBParser class >> identifier [ " See superimplementor's comment " ^ 'gb|' ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioGBParser >> initialize [ " Private - See superimplementor's comment " diff --git a/repository/BioParsers/BioGIBackBoneIdParser.class.st b/repository/BioParsers/BioGIBackBoneIdParser.class.st index 0f2aa8a6..f7ba9e78 100644 --- a/repository/BioParsers/BioGIBackBoneIdParser.class.st +++ b/repository/BioParsers/BioGIBackBoneIdParser.class.st @@ -3,12 +3,14 @@ bbs|number " Class { - #name : #BioGIBackBoneIdParser, - #superclass : #BioNCBIIdParser, - #category : 'BioParsers-Core' + #name : 'BioGIBackBoneIdParser', + #superclass : 'BioNCBIIdParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #accessing } +{ #category : 'accessing' } BioGIBackBoneIdParser class >> identifier [ " See superimplementor's comment " diff --git a/repository/BioParsers/BioGIParser.class.st b/repository/BioParsers/BioGIParser.class.st index 82933889..533b67c9 100644 --- a/repository/BioParsers/BioGIParser.class.st +++ b/repository/BioParsers/BioGIParser.class.st @@ -5,19 +5,21 @@ gi|integer " Class { - #name : #BioGIParser, - #superclass : #BioNCBIIdParser, - #category : 'BioParsers-Core' + #name : 'BioGIParser', + #superclass : 'BioNCBIIdParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #accessing } +{ #category : 'accessing' } BioGIParser class >> identifier [ " See superimplementor's comment " ^ 'gi|' ] -{ #category : #accessing } +{ #category : 'accessing' } BioGIParser >> buildTokens: aCollection [ " Answer a Collection object for the receiver's parsing output " @@ -25,7 +27,7 @@ BioGIParser >> buildTokens: aCollection [ ^ self results ] -{ #category : #accessing } +{ #category : 'accessing' } BioGIParser >> tokenizeGi: aString [ " Refer to comment in class side " diff --git a/repository/BioParsers/BioGenBankAssociation.class.st b/repository/BioParsers/BioGenBankAssociation.class.st index 2e2bdfa5..f0fcb927 100644 --- a/repository/BioParsers/BioGenBankAssociation.class.st +++ b/repository/BioParsers/BioGenBankAssociation.class.st @@ -1,10 +1,12 @@ Class { - #name : #BioGenBankAssociation, - #superclass : #Association, - #category : 'BioParsers-XML' + #name : 'BioGenBankAssociation', + #superclass : 'Association', + #category : 'BioParsers-XML', + #package : 'BioParsers', + #tag : 'XML' } -{ #category : #accessing } +{ #category : 'accessing' } BioGenBankAssociation >> displayAsPCTResult [ ^ self key , ' -> ' , self value diff --git a/repository/BioParsers/BioGenBankRecord.class.st b/repository/BioParsers/BioGenBankRecord.class.st index a01db91d..981c22c8 100644 --- a/repository/BioParsers/BioGenBankRecord.class.st +++ b/repository/BioParsers/BioGenBankRecord.class.st @@ -1,5 +1,7 @@ Class { - #name : #BioGenBankRecord, - #superclass : #BioPropertyObject, - #category : 'BioParsers-XML' + #name : 'BioGenBankRecord', + #superclass : 'BioPropertyObject', + #category : 'BioParsers-XML', + #package : 'BioParsers', + #tag : 'XML' } diff --git a/repository/BioParsers/BioIDParser.class.st b/repository/BioParsers/BioIDParser.class.st index e1a7d09f..460338af 100644 --- a/repository/BioParsers/BioIDParser.class.st +++ b/repository/BioParsers/BioIDParser.class.st @@ -5,30 +5,32 @@ This class is not intended to be used directly. " Class { - #name : #BioIDParser, - #superclass : #BioFASTAParser, - #category : #'BioParsers-Core' + #name : 'BioIDParser', + #superclass : 'BioFASTAParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioIDParser >> parserForCompositeId [ ^ BioCompositeIDParser new parser ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioIDParser >> parserForDdbj [ ^ BioDDBJParser new parser ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioIDParser >> parserForEmbl [ ^ BioEMBLParser new parser ] -{ #category : #'accessing-parsers' } +{ #category : 'accessing-parsers' } BioIDParser >> parserForGenBank [ " This is GB " diff --git a/repository/BioParsers/BioLocalParser.class.st b/repository/BioParsers/BioLocalParser.class.st index b71d2ddd..4ef27407 100644 --- a/repository/BioParsers/BioLocalParser.class.st +++ b/repository/BioParsers/BioLocalParser.class.st @@ -3,12 +3,14 @@ lcl|identifier " Class { - #name : #BioLocalParser, - #superclass : #BioNCBIIdParser, - #category : 'BioParsers-Core' + #name : 'BioLocalParser', + #superclass : 'BioNCBIIdParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #accessing } +{ #category : 'accessing' } BioLocalParser class >> identifier [ " See superimplementor's comment " diff --git a/repository/BioParsers/BioMAFParser.class.st b/repository/BioParsers/BioMAFParser.class.st index 6e6497f7..646b8b90 100644 --- a/repository/BioParsers/BioMAFParser.class.st +++ b/repository/BioParsers/BioMAFParser.class.st @@ -4,12 +4,14 @@ This is work in progress " Class { - #name : #BioMAFParser, - #superclass : #BioAbstractTextParser, - #category : #'BioParsers-Core' + #name : 'BioMAFParser', + #superclass : 'BioAbstractTextParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #initialization } +{ #category : 'initialization' } BioMAFParser >> initialize [ " Private - See superimplementor's comment " @@ -19,7 +21,7 @@ BioMAFParser >> initialize [ ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioMAFParser >> mafBodyParser [ | mafSrc mafStart mafSize mafStrand mafSrcSize mafSeqAlign mafSequence mafAlignParams mafScore mafPass mafAlignBlock mafBody | @@ -40,7 +42,7 @@ BioMAFParser >> mafBodyParser [ ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioMAFParser >> mafHeaderParser [ | mafProgram mafScoringScheme mafScoring mafVersion mafVar mafOptions mafHeader | diff --git a/repository/BioParsers/BioNCBIBlastSAXParser.class.st b/repository/BioParsers/BioNCBIBlastSAXParser.class.st index b1f7816f..d136a377 100644 --- a/repository/BioParsers/BioNCBIBlastSAXParser.class.st +++ b/repository/BioParsers/BioNCBIBlastSAXParser.class.st @@ -1,10 +1,12 @@ Class { - #name : #BioNCBIBlastSAXParser, - #superclass : #BioSAXParser, - #category : #'BioParsers-Core' + #name : 'BioNCBIBlastSAXParser', + #superclass : 'BioSAXParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #'handling - content' } +{ #category : 'handling - content' } BioNCBIBlastSAXParser >> characters: aString [ " This call corresponds to the Java SAX call characters(char[] ch, int start, int length)." @@ -15,14 +17,14 @@ BioNCBIBlastSAXParser >> characters: aString [ results addNode: current ] ] ] -{ #category : #private } +{ #category : 'private' } BioNCBIBlastSAXParser >> estimatedResultSize [ " Private - See superimplementor's comment " ^ 500 ] -{ #category : #private } +{ #category : 'private' } BioNCBIBlastSAXParser >> resultClass [ " Private - See superimplementor's comment " @@ -30,14 +32,14 @@ BioNCBIBlastSAXParser >> resultClass [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioNCBIBlastSAXParser >> selectNodes: aCollection [ " Private - Structure nodes are added to preserve the result tree structure" selectedNodes := aCollection , BioBlastStructureNode nodes ] -{ #category : #'handling - content' } +{ #category : 'handling - content' } BioNCBIBlastSAXParser >> startElement: elementName attributeList: attributeList [ " Private - Included because older version of the SAX parser contains this method " @@ -47,7 +49,7 @@ BioNCBIBlastSAXParser >> startElement: elementName attributeList: attributeList ifNotNil: [ :arg | current addToRoot: results ] ] ] -{ #category : #'handling - content' } +{ #category : 'handling - content' } BioNCBIBlastSAXParser >> startElement: elementName attributes: attributeList [ " Probably obsolete " diff --git a/repository/BioParsers/BioNCBIBlastSAXTokenizer.class.st b/repository/BioParsers/BioNCBIBlastSAXTokenizer.class.st index 9b37779e..f38a0dfe 100644 --- a/repository/BioParsers/BioNCBIBlastSAXTokenizer.class.st +++ b/repository/BioParsers/BioNCBIBlastSAXTokenizer.class.st @@ -1,10 +1,12 @@ Class { - #name : #BioNCBIBlastSAXTokenizer, - #superclass : #BioNCBIBlastSAXParser, - #category : #'BioParsers-Core' + #name : 'BioNCBIBlastSAXTokenizer', + #superclass : 'BioNCBIBlastSAXParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #'handling - content' } +{ #category : 'handling - content' } BioNCBIBlastSAXTokenizer >> characters: aString [ "This call corresponds to the Java SAX call characters(char[] ch, int start, int length)." @@ -14,14 +16,14 @@ BioNCBIBlastSAXTokenizer >> characters: aString [ self catchOff ]. ] -{ #category : #'handling - content' } +{ #category : 'handling - content' } BioNCBIBlastSAXTokenizer >> resultClass [ " Private - See superimplementor's comment " ^ OrderedCollection ] -{ #category : #'handling - content' } +{ #category : 'handling - content' } BioNCBIBlastSAXTokenizer >> startElement: elementName attributes: attributeList [ (self selectedNodes includes: elementName) ifFalse: [ ^ self ]. diff --git a/repository/BioParsers/BioNCBIGenericIdParser.class.st b/repository/BioParsers/BioNCBIGenericIdParser.class.st index 8ab04068..552cd7d3 100644 --- a/repository/BioParsers/BioNCBIGenericIdParser.class.st +++ b/repository/BioParsers/BioNCBIGenericIdParser.class.st @@ -3,25 +3,27 @@ gnl|database|identifier " Class { - #name : #BioNCBIGenericIdParser, - #superclass : #BioNCBIIdParser, - #category : #'BioParsers-Core' + #name : 'BioNCBIGenericIdParser', + #superclass : 'BioNCBIIdParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #accessing } +{ #category : 'accessing' } BioNCBIGenericIdParser class >> identifier [ " See superimplementor's comment " ^ 'gnl|' ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioNCBIGenericIdParser >> databaseParser [ ^ self parserForNonFastaString ] -{ #category : #initialization } +{ #category : 'initialization' } BioNCBIGenericIdParser >> initialize [ " Private - See superimplementor's comment " diff --git a/repository/BioParsers/BioNCBIIdParser.class.st b/repository/BioParsers/BioNCBIIdParser.class.st index 3b09abc8..909f80da 100644 --- a/repository/BioParsers/BioNCBIIdParser.class.st +++ b/repository/BioParsers/BioNCBIIdParser.class.st @@ -1,10 +1,12 @@ Class { - #name : #BioNCBIIdParser, - #superclass : #BioIDParser, - #category : #'BioParsers-Core' + #name : 'BioNCBIIdParser', + #superclass : 'BioIDParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #accessing } +{ #category : 'accessing' } BioNCBIIdParser class >> allIdentifiers [ " Answer a " @@ -15,7 +17,7 @@ BioNCBIIdParser class >> allIdentifiers [ ifFalse: [ id ] ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioNCBIIdParser class >> classFor: aString [ " Answer a class which identifies aString " @@ -25,7 +27,7 @@ BioNCBIIdParser class >> classFor: aString [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioNCBIIdParser class >> identifier [ " Answer a class appropiate for parsing a specified NCBI identifier String " @@ -35,21 +37,21 @@ BioNCBIIdParser class >> identifier [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioNCBIIdParser >> identifier [ " Answer the identifying String of the receiver " ^ self class identifier ] -{ #category : #initialization } +{ #category : 'initialization' } BioNCBIIdParser >> initialize [ " Private - See superimplementor's comment " parser := self parserForIdentifier , #number asPParser ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioNCBIIdParser >> localIdParser [ ^ self parserForNonFastaString diff --git a/repository/BioParsers/BioNCBILocusParser.class.st b/repository/BioParsers/BioNCBILocusParser.class.st index a498378f..a14d5d34 100644 --- a/repository/BioParsers/BioNCBILocusParser.class.st +++ b/repository/BioParsers/BioNCBILocusParser.class.st @@ -1,31 +1,33 @@ Class { - #name : #BioNCBILocusParser, - #superclass : #BioAccessionParser, - #category : #'BioParsers-Core' + #name : 'BioNCBILocusParser', + #superclass : 'BioAccessionParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #initialize } +{ #category : 'initialize' } BioNCBILocusParser >> initialize [ super initialize. parser := self parserForLocus ] -{ #category : #accessing } +{ #category : 'accessing' } BioNCBILocusParser >> parserForLocus [ " Answer a parser for parsing locus identifiers " ^ $| asPParser optional , self parserForNonFastaString plus flatten ] -{ #category : #accessing } +{ #category : 'accessing' } BioNCBILocusParser >> tokenizeLocus [ " Extract the locus name from the receiver's expression " ^ self tokenize third ] -{ #category : #accessing } +{ #category : 'accessing' } BioNCBILocusParser >> tokenizeLocus: aString [ " Refer to comment in class side " diff --git a/repository/BioParsers/BioNCBIXMLBlastParser.class.st b/repository/BioParsers/BioNCBIXMLBlastParser.class.st index 671913e8..b9d71104 100644 --- a/repository/BioParsers/BioNCBIXMLBlastParser.class.st +++ b/repository/BioParsers/BioNCBIXMLBlastParser.class.st @@ -1,10 +1,12 @@ Class { - #name : #BioNCBIXMLBlastParser, - #superclass : #BioXMLParser, - #category : #'BioParsers-XML' + #name : 'BioNCBIXMLBlastParser', + #superclass : 'BioXMLParser', + #category : 'BioParsers-XML', + #package : 'BioParsers', + #tag : 'XML' } -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioNCBIXMLBlastParser >> initializeWith: aString [ " Private - Set the receiver's parser " @@ -12,7 +14,7 @@ BioNCBIXMLBlastParser >> initializeWith: aString [ parser := XMLPullParser parse: self expression. ] -{ #category : #accessing } +{ #category : 'accessing' } BioNCBIXMLBlastParser >> scanHits [ " Private - Scan and save the selected receiver's expression hit nodes " @@ -23,7 +25,7 @@ BioNCBIXMLBlastParser >> scanHits [ parser next ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioNCBIXMLBlastParser >> tokenizeHeader [ " Parse the receiver expression and answer the header nodes found " @@ -36,7 +38,7 @@ BioNCBIXMLBlastParser >> tokenizeHeader [ ^ self results ] -{ #category : #accessing } +{ #category : 'accessing' } BioNCBIXMLBlastParser >> tokenizeHits [ " Parse the receiver expression and answer the selected nodes found " diff --git a/repository/BioParsers/BioParser.class.st b/repository/BioParsers/BioParser.class.st index 6215a0eb..b39429f5 100644 --- a/repository/BioParsers/BioParser.class.st +++ b/repository/BioParsers/BioParser.class.st @@ -41,33 +41,35 @@ Format of database identifiers Local Sequence identifier lcl|identifier " Class { - #name : #BioParser, - #superclass : #BioObject, - #category : #'BioParsers-Core' + #name : 'BioParser', + #superclass : 'BioObject', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #'parse-ncbi-identifiers' } +{ #category : 'parse-ncbi-identifiers' } BioParser class >> parseAccession: aString [ " Parse aString containing an accession number and answer an accession instance " ^ (BioAccessionParser on: aString) parse ] -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioParser class >> parseAmbiguousWithSeparators: aSequenceString [ " Parse aSequenceString containing an ambiguous sequence " ^ (BioAmbiguousBaseParser on: aSequenceString) parseWithSeparators ] -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioParser class >> parseAmbiguousWithoutSeparators: aSequenceString [ " Parse aSequenceString containing an ambiguous sequence " ^ (BioAmbiguousBaseParser on: aSequenceString) parseWithoutSeparators ] -{ #category : #'parse-ncbi-xml' } +{ #category : 'parse-ncbi-xml' } BioParser class >> parseDocumentFrom: anObject [ " Answer a Collection of header nodes found in anObject " @@ -76,35 +78,35 @@ BioParser class >> parseDocumentFrom: anObject [ parse: anObject ] -{ #category : #'parse-fasta' } +{ #category : 'parse-fasta' } BioParser class >> parseFasta: aFastaString [ " Parse aFastaString and answer a single fasta instance " ^ (BioFASTABasicParser on: aFastaString) parse ] -{ #category : #'parse-fasta' } +{ #category : 'parse-fasta' } BioParser class >> parseFastaFile: aFilepath [ " Parse aFastaString and answer a single fasta instance " ^ (BioFASTABasicParser on: aFilepath contents) parse ] -{ #category : #'parse-ncbi-genbank' } +{ #category : 'parse-ncbi-genbank' } BioParser class >> parseFlatGenBank: aGenBankString [ " Parse aGenBankString and answer a single fasta instance " ^ (BioFlatGenBankParser on: aGenBankString) parse ] -{ #category : #'parse-ncbi-xml' } +{ #category : 'parse-ncbi-xml' } BioParser class >> parseFullNcbiXmlGBSeq: aString [ " Answer a of header nodes found in aString " ^ BioEntrezXMLGBSeqFullParser parse: aString ] -{ #category : #'parse-fasta' } +{ #category : 'parse-fasta' } BioParser class >> parseMultiFasta: aFastaString [ " Parser aFastaString representing a MultiFASTA sequence. Answer a FastaMultiRecord object " @@ -112,7 +114,7 @@ BioParser class >> parseMultiFasta: aFastaString [ ^ (BioFASTAMultiParser on: aFastaString) parse ] -{ #category : #'parse-fasta' } +{ #category : 'parse-fasta' } BioParser class >> parseMultiFastaAlignment: aFastaString [ " Parser aFastaString representing a containing multiple sequences in FASTA format. Answer a object " @@ -120,21 +122,21 @@ BioParser class >> parseMultiFastaAlignment: aFastaString [ ^ (BioFASTAMultiParser on: aFastaString) parse ] -{ #category : #'parse-fasta' } +{ #category : 'parse-fasta' } BioParser class >> parseMultiFastaAlignmentFile: aFastaFullFileLocation [ " Parse aFastaFullFileLocation representing a containing a file with multiple sequences in FASTA format. Answer a object " ^ (BioFASTAMultiParser on: (self openFullFileNamed: aFastaFullFileLocation) contents) parse asAlignment ] -{ #category : #'parse-fasta' } +{ #category : 'parse-fasta' } BioParser class >> parseMultiFastaFile: aFastaFullFileLocation [ " Parse aFastaFullFileLocation (extensions .fa, .fasta, .fas, etc) representing a MultiFASTA sequence, i.e. a file which contains multiple fasta sequences. Answer a object " ^ (BioFASTAMultiParser on: (self openFullFileNamed: aFastaFullFileLocation) contents) parse ] -{ #category : #'parse-ncbi-xml' } +{ #category : 'parse-ncbi-xml' } BioParser class >> parseNcbiXmlBlast: aString nodes: nodesCollection [ " Parse with nodesCollection and answer a of nodes found in aString " @@ -143,28 +145,28 @@ BioParser class >> parseNcbiXmlBlast: aString nodes: nodesCollection [ parse ] -{ #category : #'parse-ncbi-xml' } +{ #category : 'parse-ncbi-xml' } BioParser class >> parseNcbiXmlGBSeq: aString [ " Answer a of header nodes found in aString " ^ BioEntrezXMLGBBasicParser parse: aString ] -{ #category : #'parse-phylip' } +{ #category : 'parse-phylip' } BioParser class >> parsePhylipInterleavedDNA: aPhylipString [ " Parse aPhylipString and answer a BioPhylip object with contents filled " ^ ( BioPhylipParser on: aPhylipString ) parseDna ] -{ #category : #'parse-phylip' } +{ #category : 'parse-phylip' } BioParser class >> parsePhylipInterleavedProtein: aPhylipString [ " Parse aPhylipString and answer a BioPhylip object with contents filled " ^ ( BioPhylipParser on: aPhylipString ) parseProtein ] -{ #category : #'parse-ncbi-xml' } +{ #category : 'parse-ncbi-xml' } BioParser class >> saxParseNcbiXmlBlast: anObject nodes: aCollection [ " Answer a Collection of nodes found in anObject " @@ -173,7 +175,7 @@ BioParser class >> saxParseNcbiXmlBlast: anObject nodes: aCollection [ parse: anObject ] -{ #category : #'parse-ncbi-xml' } +{ #category : 'parse-ncbi-xml' } BioParser class >> saxParseNcbiXmlBlastNodes: anObject [ " Answer a Collection of header nodes found in anObject " @@ -182,7 +184,7 @@ BioParser class >> saxParseNcbiXmlBlastNodes: anObject [ parse: anObject ] -{ #category : #'parse-ncbi-xml' } +{ #category : 'parse-ncbi-xml' } BioParser class >> saxTokenizeNcbiXmlBlast: anObject nodes: aBlock [ " Answer a Collection of nodes found in anObject " @@ -191,7 +193,7 @@ BioParser class >> saxTokenizeNcbiXmlBlast: anObject nodes: aBlock [ parse: anObject ] -{ #category : #'parse-ncbi-xml' } +{ #category : 'parse-ncbi-xml' } BioParser class >> saxTokenizeNcbiXmlBlast: anObject nodes: nodes conditionBlock: aBlock [ " Answer a Collection of nodes found in anObject " @@ -201,7 +203,7 @@ BioParser class >> saxTokenizeNcbiXmlBlast: anObject nodes: nodes conditionBlock parse: anObject ] -{ #category : #'parse-ncbi-xml' } +{ #category : 'parse-ncbi-xml' } BioParser class >> saxTokenizeNcbiXmlBlastNodes: anObject [ " Answer a Collection of nodes found in anObject " @@ -210,35 +212,35 @@ BioParser class >> saxTokenizeNcbiXmlBlastNodes: anObject [ parse: anObject ] -{ #category : #'parse-ncbi-identifiers' } +{ #category : 'parse-ncbi-identifiers' } BioParser class >> tokenizeAccession: aString [ " Tokenize aString containing an accession number " ^ (BioAccessionParser on: aString) tokenize ] -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioParser class >> tokenizeAmbiguousLettersToSeparators: aSequenceString [ " Tokenize aString containing an ambiguous sequence without separators, i.e. [ACT] " ^ (BioAmbiguousBaseParser on: aSequenceString) tokenizeWithoutSeparators ] -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioParser class >> tokenizeAmbiguousWithSeparators: aSequenceString [ " Tokenize aString containing an ambiguous sequence delimited with separators, i.e. [A/C/T] " ^ (BioAmbiguousBaseParser on: aSequenceString) tokenizeWithSeparators ] -{ #category : #'instance creation' } +{ #category : 'instance creation' } BioParser class >> tokenizeAmbiguousWithoutSeparators: aSequenceString [ " Tokenize aString containing an ambiguous sequence without separators, i.e. [ACT] " ^ (BioAmbiguousBaseParser on: aSequenceString) tokenizeWithoutSeparators ] -{ #category : #'parse-csv' } +{ #category : 'parse-csv' } BioParser class >> tokenizeCSV: aCSVStringOrStream delimiter: aCharacter [ " Tokenize aCSVStringOrStream with CSV format " @@ -247,28 +249,28 @@ BioParser class >> tokenizeCSV: aCSVStringOrStream delimiter: aCharacter [ upToEnd ] -{ #category : #'parse-fasta' } +{ #category : 'parse-fasta' } BioParser class >> tokenizeFasta: aString [ " Tokenize aString representing a FASTA sequence " ^ (BioFASTABasicParser on: aString) tokenize first ] -{ #category : #'parse-fasta' } +{ #category : 'parse-fasta' } BioParser class >> tokenizeFastaDescription: aString [ " Tokenize aString representing a FASTA header String " ^ (BioFASTAParser on: aString) tokenizeDescriptionText ] -{ #category : #'parse-fasta' } +{ #category : 'parse-fasta' } BioParser class >> tokenizeFastaHeader: aString [ " Tokenize aString representing a FASTA header String " ^ (BioFASTAParser on: aString) tokenizeDescriptionLine ] -{ #category : #'parse-ncbi-identifiers' } +{ #category : 'parse-ncbi-identifiers' } BioParser class >> tokenizeGi: aString [ " Tokenize aString containing a gene identifier. If aString does not begin with 'gi|' then answer an empty Collection " @@ -280,42 +282,42 @@ BioParser class >> tokenizeGi: aString [ ] -{ #category : #'parse-ncbi-identifiers' } +{ #category : 'parse-ncbi-identifiers' } BioParser class >> tokenizeLocus: aString [ " Tokenize aString containing an accession number " ^ ( BioGBParser on: aString ) tokenizeLocus ] -{ #category : #'parse-fasta' } +{ #category : 'parse-fasta' } BioParser class >> tokenizeMultiFasta: aString [ " Tokenize aString representing a MultiFASTA sequence " ^ (BioFASTABasicParser on: aString) tokenize ] -{ #category : #'parse-fasta' } +{ #category : 'parse-fasta' } BioParser class >> tokenizeMultiFastaFile: aFastaFullFileLocation [ " Tokenize aString representing a MultiFASTA sequence " ^ (BioFASTABasicParser on: (self openFullFileNamed: aFastaFullFileLocation) contents) tokenize ] -{ #category : #'parse-ncbi-xml' } +{ #category : 'parse-ncbi-xml' } BioParser class >> tokenizeNcbiXmlBlast: aString nodes: aCollection [ " Answer a Collection of hit tokens found in aString " ^ (BioNCBIXMLBlastParser on: aString) tokenizeNodes: aCollection. ] -{ #category : #'parse-ncbi-xml' } +{ #category : 'parse-ncbi-xml' } BioParser class >> tokenizeNcbiXmlBlastHeader: aString [ " Answer a of header nodes found in aXMLString " ^ (BioNCBIXMLBlastParser on: aString) tokenizeHeader ] -{ #category : #'parse-ncbi-xml' } +{ #category : 'parse-ncbi-xml' } BioParser class >> tokenizeNcbiXmlBlastHits: xmlString [ " Answer a Collection of hit nodes found in xmlString " @@ -323,28 +325,28 @@ BioParser class >> tokenizeNcbiXmlBlastHits: xmlString [ ^ (BioNCBIXMLBlastParser on: xmlString) tokenizeHits ] -{ #category : #'parse-ncbi-xml' } +{ #category : 'parse-ncbi-xml' } BioParser class >> tokenizeNcbiXmlBlastHsps: aString [ " Answer a Collection of hsps (high scoring pairs) nodes found in aXMLString " ^ ( BioNCBIXMLBlastParser on: aString ) parseHsps ] -{ #category : #'parse-ncbi-xml' } +{ #category : 'parse-ncbi-xml' } BioParser class >> tokenizeNcbiXmlEntrezResultKeys: aString [ " Answer a Collection of hit nodes found in aXMLString " ^ BioEResultKeysParser parse: aString ] -{ #category : #'parse-ncbi-xml' } +{ #category : 'parse-ncbi-xml' } BioParser class >> tokenizeNcbiXmlEntrezSearchResult: aString [ " Answer a Collection of hit nodes found in aXMLString " ^ BioEntrezXMLGBFullParser parse: aString ] -{ #category : #'parse-ncbi-xml' } +{ #category : 'parse-ncbi-xml' } BioParser class >> tokenizeNcbiXmlEntrezSearchResult: aString nodes: aCollection [ " Answer a Collection of hit nodes found in aXMLString " @@ -352,21 +354,21 @@ BioParser class >> tokenizeNcbiXmlEntrezSearchResult: aString nodes: aCollection selectNodes: aCollection) tokenizeNodes ] -{ #category : #'parse-phylip' } +{ #category : 'parse-phylip' } BioParser class >> tokenizePhylipInterleavedDNA: aPhylipString [ " Parse aPhylipString and answer a BioPhylip object with contents filled " ^ ( BioPhylipParser on: aPhylipString ) tokenizeInterleavedDNA ] -{ #category : #'parse-phylip' } +{ #category : 'parse-phylip' } BioParser class >> tokenizePhylipInterleavedProtein: aPhylipString [ " Parse aPhylipString and answer a BioPhylip object with contents filled " ^ ( BioPhylipParser on: aPhylipString ) tokenizeInterleavedProtein ] -{ #category : #'parse-ncbi-identifiers' } +{ #category : 'parse-ncbi-identifiers' } BioParser class >> tokenizeSwissProtEntryName: aString [ " Tokenize aString representing a Swiss-Prot identifier " diff --git a/repository/BioParsers/BioPatentsParser.class.st b/repository/BioParsers/BioPatentsParser.class.st index 064fc88e..69506662 100644 --- a/repository/BioParsers/BioPatentsParser.class.st +++ b/repository/BioParsers/BioPatentsParser.class.st @@ -3,25 +3,27 @@ pat|country|number " Class { - #name : #BioPatentsParser, - #superclass : #BioNCBIIdParser, - #category : #'BioParsers-Core' + #name : 'BioPatentsParser', + #superclass : 'BioNCBIIdParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #accessing } +{ #category : 'accessing' } BioPatentsParser class >> identifier [ " See superimplementor's comment " ^ 'pat|' ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioPatentsParser >> countryParser [ ^ self parserForNonFastaString ] -{ #category : #initialization } +{ #category : 'initialization' } BioPatentsParser >> initialize [ super initialize. diff --git a/repository/BioParsers/BioPhylipParser.class.st b/repository/BioParsers/BioPhylipParser.class.st index 00f7ebe8..46e0ce8a 100644 --- a/repository/BioParsers/BioPhylipParser.class.st +++ b/repository/BioParsers/BioPhylipParser.class.st @@ -3,12 +3,14 @@ Documentation taken from http://bioweb2.pasteur.fr/docs/phylip/doc/main.html#inp " Class { - #name : #BioPhylipParser, - #superclass : #BioAbstractTextParser, - #category : #'BioParsers-Core' + #name : 'BioPhylipParser', + #superclass : 'BioAbstractTextParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #'accessing-dna' } +{ #category : 'accessing-dna' } BioPhylipParser >> buildDNAResults: aCollection [ " Answer an identified object for the receiver's parsing output " @@ -24,7 +26,7 @@ BioPhylipParser >> buildDNAResults: aCollection [ sequences: sequences. ] -{ #category : #'accessing-protein' } +{ #category : 'accessing-protein' } BioPhylipParser >> buildProteinResults: aCollection [ " Answer an identified object for the receiver's parsing output " @@ -40,7 +42,7 @@ BioPhylipParser >> buildProteinResults: aCollection [ sequences: sequences. ] -{ #category : #accessing } +{ #category : 'accessing' } BioPhylipParser >> buildTokens: aCollection [ " Answer a tokenized parsing aCollection " @@ -53,7 +55,7 @@ BioPhylipParser >> buildTokens: aCollection [ ] -{ #category : #'accessing-private' } +{ #category : 'accessing-private' } BioPhylipParser >> buildTokensBlock [ ^ [: node | @@ -63,7 +65,7 @@ BioPhylipParser >> buildTokensBlock [ with: (((node third reject: [: line | line first isEmpty ]) collect: #first) collect: #withoutBlanks ) ] ] -{ #category : #accessing } +{ #category : 'accessing' } BioPhylipParser >> buildTokensFrom: aCollection [ | taxaNumber collection seqIndex seqBlock | @@ -87,25 +89,25 @@ BioPhylipParser >> buildTokensFrom: aCollection [ ] -{ #category : #accessing } +{ #category : 'accessing' } BioPhylipParser >> buildTokensFromFirstBlock: aCollection [ ^ aCollection second collect: [: seq | seq second withoutBlanks ] ] -{ #category : #'accessing-dna' } +{ #category : 'accessing-dna' } BioPhylipParser >> dnaInterleaveLineTokenizer [ ^ (self dnaInterleaveSequenceTokenizer , #newline asPParser) star ] -{ #category : #'accessing-dna' } +{ #category : 'accessing-dna' } BioPhylipParser >> dnaInterleaveSequenceTokenizer [ ^ #dnaLetter asPParser trimBlanks star flatten ] -{ #category : #'accessing-private' } +{ #category : 'accessing-private' } BioPhylipParser >> firstLineTokenizer [ " Answer a Parser for parsing the first line of the format " @@ -120,7 +122,7 @@ BioPhylipParser >> firstLineTokenizer [ Character cr asString } ] ] -{ #category : #'accessing-dna' } +{ #category : 'accessing-dna' } BioPhylipParser >> parseInterleavedDNA: aString [ " Answer an object with the result of parsing aString with the receiver's parser " @@ -132,7 +134,7 @@ BioPhylipParser >> parseInterleavedDNA: aString [ ifFalse: [ self signalInvalidObject: parseResults ]. ] -{ #category : #'accessing-protein' } +{ #category : 'accessing-protein' } BioPhylipParser >> parseInterleavedProtein: aString [ " Answer an object with the result of parsing aString with the receiver's parser " @@ -144,13 +146,13 @@ BioPhylipParser >> parseInterleavedProtein: aString [ ifFalse: [ self signalInvalidObject: parseResults ]. ] -{ #category : #'accessing-private' } +{ #category : 'accessing-private' } BioPhylipParser >> parserForAnyButNumber [ ^ #digit asPParser negate plus , #number asPParser ==> [: n | n second ] ] -{ #category : #'accessing-dna' } +{ #category : 'accessing-dna' } BioPhylipParser >> speciesDNALineTokenizer [ " Answer a Parser for parsing the species names line " @@ -158,14 +160,14 @@ BioPhylipParser >> speciesDNALineTokenizer [ self dnaInterleaveSequenceTokenizer ] -{ #category : #'accessing-dna' } +{ #category : 'accessing-dna' } BioPhylipParser >> speciesDNANamedBlockTokenizer [ " Answer a Parser for parsing the sequence blocks " ^ (self speciesDNALineTokenizer , #newline asPParser flatten) star ] -{ #category : #'accessing-private' } +{ #category : 'accessing-private' } BioPhylipParser >> speciesFobiddenNames [ " Private - Answer a with receiver's not allowed Characters in a species name " @@ -182,13 +184,13 @@ BioPhylipParser >> speciesFobiddenNames [ yourself ] -{ #category : #accessing } +{ #category : 'accessing' } BioPhylipParser >> taxaNumberFrom: aCollection [ ^ aCollection first first asNumber ] -{ #category : #'accessing-dna' } +{ #category : 'accessing-dna' } BioPhylipParser >> tokenizeInterleavedDNA [ " Private - Tokenize the receiver's epression as DNA data " @@ -201,7 +203,7 @@ BioPhylipParser >> tokenizeInterleavedDNA [ ] -{ #category : #'accessing-protein' } +{ #category : 'accessing-protein' } BioPhylipParser >> tokenizeInterleavedProtein [ " Private - Tokenize the receiver's epression as Protein data " diff --git a/repository/BioParsers/BioProtInfoParser.class.st b/repository/BioParsers/BioProtInfoParser.class.st index 5b12c9db..888048c6 100644 --- a/repository/BioParsers/BioProtInfoParser.class.st +++ b/repository/BioParsers/BioProtInfoParser.class.st @@ -3,26 +3,28 @@ pir||entry " Class { - #name : #BioProtInfoParser, - #superclass : #BioNCBIIdParser, - #category : 'BioParsers-Core' + #name : 'BioProtInfoParser', + #superclass : 'BioNCBIIdParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #accessing } +{ #category : 'accessing' } BioProtInfoParser class >> identifier [ " See superimplementor's comment " ^ 'pir|' ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioProtInfoParser >> entryParser [ " Answer a parser for parsing entry identifiers " ^ self parserForNonFastaString ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioProtInfoParser >> initialize [ super initialize. diff --git a/repository/BioParsers/BioProtResParser.class.st b/repository/BioParsers/BioProtResParser.class.st index c7cf2a91..0fcc6a0a 100644 --- a/repository/BioParsers/BioProtResParser.class.st +++ b/repository/BioParsers/BioProtResParser.class.st @@ -3,19 +3,21 @@ prf||name " Class { - #name : #BioProtResParser, - #superclass : #BioNCBIIdParser, - #category : #'BioParsers-Core' + #name : 'BioProtResParser', + #superclass : 'BioNCBIIdParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #accessing } +{ #category : 'accessing' } BioProtResParser class >> identifier [ " See superimplementor's comment " ^ 'prf' ] -{ #category : #initialization } +{ #category : 'initialization' } BioProtResParser >> initialize [ super initialize. @@ -25,7 +27,7 @@ BioProtResParser >> initialize [ self nameParser. ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioProtResParser >> nameParser [ ^ self parserForNonFastaString diff --git a/repository/BioParsers/BioQBlastParser.class.st b/repository/BioParsers/BioQBlastParser.class.st index 31e1a8dd..b5252b65 100644 --- a/repository/BioParsers/BioQBlastParser.class.st +++ b/repository/BioParsers/BioQBlastParser.class.st @@ -1,16 +1,18 @@ Class { - #name : #BioQBlastParser, - #superclass : #BioAbstractTextParser, - #category : #'BioParsers-Core' + #name : 'BioQBlastParser', + #superclass : 'BioAbstractTextParser', + #category : 'BioParsers-Core', + #package : 'BioParsers', + #tag : 'Core' } -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioQBlastParser >> parserForQBlastInfoBegin [ ^ 'QBlastInfoBegin' asPParser negate plus , 'QBlastInfoBegin' asPParser ] -{ #category : #'initialize-release' } +{ #category : 'initialize-release' } BioQBlastParser >> parserForRID [ " Private - Answer a parser for the request time identiferi inside a NCBI WWW QBlast job request page