Skip to content

Latest commit

 

History

History
49 lines (36 loc) · 2.38 KB

File metadata and controls

49 lines (36 loc) · 2.38 KB

Python 2 Problem Set -- Operators, Truth, Logic

  1. Use the Interactive Interpretor to test to see if you can find an ['ATG' in] the following DNA string:
GTACCTTGATTTCGTATTCTGAGAGGCTGCTGCTTAGCGGTAGCCCCTTGGTTTCCGTGGCAACGGAAAA
  1. How about 'TTT'?

  2. If you didn't already save the DNA string to a variable, do that now and redo 1 and 2.

  3. In the interpretor use bool to test a variety of values like '', 0, 0.0, FALSE, false, True, true, 'True', 'False' to see if they evalue to True or False.

  4. Using a text editor, write a script that

    • Assigns a value to a variable
    • Has a if/else statment in which:
      • It prints out a confirmation of truth if the value is true
      • It prints out "Not True" if the value is not true.
  5. Write a new script that does the same as the question #5, but gets the value you will store in the variable from the command line. Remember sys in the notes.

  6. Create a script that has a if/else statement that (remember to write a little bit at a time and test it)

    • Test to see if a number is positive or negative
    • print "positive" if it is positive
    • print "negative" if it is negative
    • save it and run it.
  7. Add an elif to test if the number is equal to 0. Save it and run it.

  8. Add nested tests to your last script

    • if it is positive, in addition to printing "positive"
    • test if it is smaller than 50
    • save it and run it
  9. Add more nested tests to your script.

    • if it is smaller than 50
    • test if the number is even
    • if it is smaller than 50 and even, print "it is an even number that is smaller than 50"
    • save it and run it
  10. Add more nested tests.

    • if it is larger than 50,
    • test if the number is divisible by 3
    • if the number is larger than 50 and divisible by 3, print "it is larger than 50 and divisible by 3"
    • save it and run it
  11. In your previous nested loops, test the number 50. What prints to the screen? Is it the correct response? If not, you have a semantic error and need to alter your code to be correct with any number.