From da6526f33e6b2d64e397e444abfb7947b54c6558 Mon Sep 17 00:00:00 2001 From: Jay Hesselberth Date: Sun, 10 May 2026 09:55:30 -0600 Subject: [PATCH 1/3] Add elbow-form layout for plot_tRNA_structure() MIME-Version: 1.0 Content-Type: text/plain; charset=UTF-8 Content-Transfer-Encoding: 8bit Adds a `layout = c("cloverleaf", "elbow")` argument to `plot_tRNA_structure()` and `structure_trnas()`. The elbow form stacks the acceptor stem and T-arm coaxially at the top, with the D-arm extending horizontally and the anticodon arm hanging vertically — matching the L-shape depiction common in structural biology figures. Geometry is derived from canonical Sprinzl labels via `inst/extdata/sprinzl/ecoliK12_global_coords.tsv.gz`, so a single coordinate table works across all standard tRNAs. The new generator `data-raw/structures/generate_elbow.py` reads each cloverleaf JSON's sequence, looks up Sprinzl labels, and writes elbow SVG + JSON in the same schema as cloverleaf — overlay code (modifications, outlines, linkages, position markers, end labels) works unchanged. v1 ships 29 E. coli standard 3-arm tRNAs. Variable-arm tRNAs (Leu, Ser, SeC, Tyr) are deferred to v2. Co-Authored-By: Claude Opus 4.7 (1M context) --- NEWS.md | 2 + R/plot-structure.R | 46 +- data-raw/structures/generate_elbow.py | 518 +++++++++++++++ .../Escherichia_coli/elbow/tRNA-Ala-GGC.json | 593 +++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Ala-GGC.svg | 261 ++++++++ .../Escherichia_coli/elbow/tRNA-Ala-TGC.json | 593 +++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Ala-TGC.svg | 261 ++++++++ .../Escherichia_coli/elbow/tRNA-Arg-ACG.json | 599 ++++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Arg-ACG.svg | 264 ++++++++ .../Escherichia_coli/elbow/tRNA-Arg-CCG.json | 599 ++++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Arg-CCG.svg | 264 ++++++++ .../Escherichia_coli/elbow/tRNA-Arg-CCT.json | 587 +++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Arg-CCT.svg | 258 ++++++++ .../Escherichia_coli/elbow/tRNA-Arg-TCT.json | 599 ++++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Arg-TCT.svg | 264 ++++++++ .../Escherichia_coli/elbow/tRNA-Asn-GTT.json | 593 +++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Asn-GTT.svg | 261 ++++++++ .../Escherichia_coli/elbow/tRNA-Asp-GTC.json | 599 ++++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Asp-GTC.svg | 264 ++++++++ .../Escherichia_coli/elbow/tRNA-Cys-GCA.json | 581 +++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Cys-GCA.svg | 255 ++++++++ .../Escherichia_coli/elbow/tRNA-Gln-CTG.json | 587 +++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Gln-CTG.svg | 258 ++++++++ .../Escherichia_coli/elbow/tRNA-Gln-TTG.json | 587 +++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Gln-TTG.svg | 258 ++++++++ .../Escherichia_coli/elbow/tRNA-Glu-TTC.json | 593 +++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Glu-TTC.svg | 261 ++++++++ .../Escherichia_coli/elbow/tRNA-Gly-CCC.json | 581 +++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Gly-CCC.svg | 255 ++++++++ .../Escherichia_coli/elbow/tRNA-Gly-GCC.json | 593 +++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Gly-GCC.svg | 261 ++++++++ .../Escherichia_coli/elbow/tRNA-Gly-TCC.json | 587 +++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Gly-TCC.svg | 258 ++++++++ .../Escherichia_coli/elbow/tRNA-His-GTG.json | 593 +++++++++++++++++ .../Escherichia_coli/elbow/tRNA-His-GTG.svg | 261 ++++++++ .../Escherichia_coli/elbow/tRNA-Ile-GAT.json | 599 ++++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Ile-GAT.svg | 264 ++++++++ .../Escherichia_coli/elbow/tRNA-Lys-TTT.json | 593 +++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Lys-TTT.svg | 261 ++++++++ .../Escherichia_coli/elbow/tRNA-Met-CAT.json | 599 ++++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Met-CAT.svg | 264 ++++++++ .../Escherichia_coli/elbow/tRNA-Phe-GAA.json | 593 +++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Phe-GAA.svg | 261 ++++++++ .../Escherichia_coli/elbow/tRNA-Pro-CGG.json | 599 ++++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Pro-CGG.svg | 264 ++++++++ .../Escherichia_coli/elbow/tRNA-Pro-GGG.json | 599 ++++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Pro-GGG.svg | 264 ++++++++ .../Escherichia_coli/elbow/tRNA-Pro-TGG.json | 599 ++++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Pro-TGG.svg | 264 ++++++++ .../Escherichia_coli/elbow/tRNA-Thr-CGT.json | 593 +++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Thr-CGT.svg | 261 ++++++++ .../Escherichia_coli/elbow/tRNA-Thr-GGT.json | 593 +++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Thr-GGT.svg | 261 ++++++++ .../Escherichia_coli/elbow/tRNA-Thr-TGT.json | 593 +++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Thr-TGT.svg | 261 ++++++++ .../Escherichia_coli/elbow/tRNA-Trp-CCA.json | 593 +++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Trp-CCA.svg | 261 ++++++++ .../Escherichia_coli/elbow/tRNA-Val-GAC.json | 599 ++++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Val-GAC.svg | 264 ++++++++ .../Escherichia_coli/elbow/tRNA-Val-TAC.json | 593 +++++++++++++++++ .../Escherichia_coli/elbow/tRNA-Val-TAC.svg | 261 ++++++++ man/plot_tRNA_structure.Rd | 11 +- man/structure_trnas.Rd | 10 +- tests/testthat/_snaps/plot-structure.md | 19 +- tests/testthat/test-plot-structure.R | 50 ++ 65 files changed, 25417 insertions(+), 23 deletions(-) create mode 100644 data-raw/structures/generate_elbow.py create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.svg create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.json create mode 100644 inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.svg diff --git a/NEWS.md b/NEWS.md index d4cfa50..f7c1396 100644 --- a/NEWS.md +++ b/NEWS.md @@ -28,6 +28,8 @@ * `filter_linkages()` filters odds ratio data by p-value, observation count, and log odds ratio magnitude, returning a tibble ready for the `linkages` parameter of `plot_tRNA_structure()`. +* `plot_tRNA_structure()` gains a `layout` argument with `"cloverleaf"` (default) and `"elbow"` forms; the elbow form stacks the acceptor stem and T-arm coaxially at the top with the D-arm extending horizontally and the anticodon arm vertically. Currently bundled for E. coli standard 3-arm tRNAs. `structure_trnas()` accepts the same `layout` argument. + * `plot_tRNA_structure()` now accepts odds ratio tibbles directly as `linkages` input: if a `log_odds_ratio` column is present and `value` is not, it is automatically used as the arc value. * `plot_tRNA_structure()` now draws a 3' amino acid label (e.g., "Glu") connected by a line to the terminal nucleotide, and position markers every 10 nucleotides around the cloverleaf. Position markers can be disabled with `position_markers = FALSE`. diff --git a/R/plot-structure.R b/R/plot-structure.R index a257a2a..756343e 100644 --- a/R/plot-structure.R +++ b/R/plot-structure.R @@ -27,12 +27,14 @@ structure_organisms <- function() { #' List available tRNA structures for an organism #' -#' Returns the names of tRNAs for which cloverleaf structure SVGs -#' are bundled with the package for the given organism. +#' Returns the names of tRNAs for which structure SVGs are bundled with +#' the package for the given organism and layout. #' #' @param organism Character string specifying the organism name #' (e.g., `"Escherichia coli"`). Use [structure_organisms()] to #' list available organisms. +#' @param layout One of `"cloverleaf"` (default) or `"elbow"`. The +#' elbow form is currently bundled for E. coli standard tRNAs only. #' #' @return A character vector of tRNA names. #' @@ -40,9 +42,19 @@ structure_organisms <- function() { #' #' @examples #' structure_trnas("Escherichia coli") -structure_trnas <- function(organism) { +#' structure_trnas("Escherichia coli", layout = "elbow") +structure_trnas <- function(organism, layout = c("cloverleaf", "elbow")) { + layout <- match.arg(layout) org_dir <- structure_org_dir(organism) - svg_files <- list.files(org_dir, pattern = "\\.svg$") + svg_dir <- if (layout == "cloverleaf") { + org_dir + } else { + file.path(org_dir, "elbow") + } + if (!dir.exists(svg_dir)) { + return(character(0)) + } + svg_files <- list.files(svg_dir, pattern = "\\.svg$") tools::file_path_sans_ext(svg_files) } @@ -89,6 +101,12 @@ structure_trnas <- function(organism) { #' linkage values. Default `c("#0072B2", "#D55E00")` (blue for #' exclusive, vermillion for co-occurring). Stroke width encodes #' the magnitude of the value. +#' @param layout One of `"cloverleaf"` (default) or `"elbow"`. +#' `"elbow"` renders the L-shaped depiction with the acceptor stem +#' and T-arm stacked coaxially at the top, the D-arm extending +#' horizontally, and the anticodon arm hanging vertically. The +#' elbow form is currently available for E. coli standard +#' 3-arm tRNAs. #' #' @return The path to the annotated SVG file (invisibly). #' @@ -97,6 +115,7 @@ structure_trnas <- function(organism) { #' @examples #' \donttest{ #' plot_tRNA_structure("tRNA-Glu-TTC", "Escherichia coli") +#' plot_tRNA_structure("tRNA-Phe-GAA", "Escherichia coli", layout = "elbow") #' } plot_tRNA_structure <- function( trna, @@ -109,24 +128,31 @@ plot_tRNA_structure <- function( outline_palette = NULL, text_colors = NULL, position_markers = TRUE, - linkage_palette = c("#0072B2", "#D55E00") + linkage_palette = c("#0072B2", "#D55E00"), + layout = c("cloverleaf", "elbow") ) { rlang::check_installed("jsonlite", reason = "to read structure metadata.") + layout <- match.arg(layout) org_dir <- structure_org_dir(organism) + layout_dir <- if (layout == "cloverleaf") { + org_dir + } else { + file.path(org_dir, "elbow") + } - svg_path <- file.path(org_dir, paste0(trna, ".svg")) - json_path <- file.path(org_dir, paste0(trna, ".json")) + svg_path <- file.path(layout_dir, paste0(trna, ".svg")) + json_path <- file.path(layout_dir, paste0(trna, ".json")) if (!file.exists(svg_path)) { cli::cli_abort(c( - "No structure SVG found for {.val {trna}}.", - "i" = "Use {.fn structure_trnas} to list available tRNAs." + "No {layout} structure SVG found for {.val {trna}}.", + "i" = "Use {.code structure_trnas({.val {organism}}, layout = {.val {layout}})} to list available tRNAs." )) } if (!file.exists(json_path)) { cli::cli_abort( - "No position metadata found for {.val {trna}}." + "No position metadata found for {.val {trna}} in {layout} layout." ) } diff --git a/data-raw/structures/generate_elbow.py b/data-raw/structures/generate_elbow.py new file mode 100644 index 0000000..8911f05 --- /dev/null +++ b/data-raw/structures/generate_elbow.py @@ -0,0 +1,518 @@ +"""Generate tRNA elbow-form SVGs from existing cloverleaf JSON metadata. + +Reads each E. coli tRNA's existing JSON (for sequence) and the Sprinzl +coordinates TSV (for per-position canonical Sprinzl labels), then emits an +elbow-form SVG and JSON in the SAME schema as the cloverleaf path. The +R-side overlay code in plot_tRNA_structure() consumes both layouts +identically. + +The elbow form (per Matsumoto et al., JBC 2026; see also classical +structural-biology depictions) lays out the molecule so that the acceptor +stem and T-arm are stacked coaxially as one horizontal helix at the top, +the D-arm extends horizontally to the left below it, the anticodon arm +hangs vertically below, and the variable region forms a small bulge +between the AC-stem and T-stem. + +Skips variable-arm tRNAs (Leu, Ser, SeC, Tyr, some Thr) — those will need +a v2 layout that handles the variable arm. + +Usage +----- + pixi run -e struct python data-raw/structures/generate_elbow.py +""" + +from __future__ import annotations + +import csv +import gzip +import json +import math +import re +import sys +from pathlib import Path + +# --- paths -------------------------------------------------------------- + +PROJECT_ROOT = Path(__file__).resolve().parent.parent.parent +SCRIPT_DIR = Path(__file__).resolve().parent +STRUCTURES_DIR = PROJECT_ROOT / "inst" / "extdata" / "structures" +SPRINZL_DIR = PROJECT_ROOT / "inst" / "extdata" / "sprinzl" + +# Map organism dir name -> Sprinzl coords filename +ORG_SPRINZL = { + "Escherichia_coli": "ecoliK12_global_coords.tsv.gz", +} + +# --- layout constants --------------------------------------------------- + +S = 7.56 # backbone spacing along a strand +P = 7.56 # vertical pair spacing between rows of a stem + +# Combined acceptor + T helix at top +TOP_Y = 35.0 # 3' strand row (acceptor 3' + T-stem 3'); CCA emerges UP from here +BOT_Y = TOP_Y + P # 5' strand row (acceptor 5' + T-stem 5'); side arms emerge DOWN from here +ACC_X1 = 195.0 # x of pos 1 (5' free end) and pos 72 (paired with pos 1) +GAP = S * 1.4 # break between T-stem and acceptor on the bottom strand + +# T-loop (54..60) curls at far LEFT of the combined helix +T_LOOP_RADIUS = 13.0 + +# D-arm: horizontal, BELOW the top stack, extending LEFT from below pos 7. +# Its junction-side end (pos 10/25) sits directly under pos 7 (acceptor 5' end). +D_TOP_Y = BOT_Y + 18.0 # top row of D-stem +D_BOT_Y = D_TOP_Y + P # bottom row of D-stem +D_LOOP_RADIUS = 12.0 + +# AC-arm: vertical, BELOW the elbow, going DOWN. AC-stem column placed under +# the elbow region (between T-stem and acceptor) so the variable region's +# path from pos 43 up to pos 49 is short and roughly vertical. +AC_X_LEFT = 132.0 +AC_X_RIGHT = AC_X_LEFT + P # column for AC-stem 3' (39..43) +AC_TOP_Y = D_BOT_Y + 22.0 # y of pos 27 (top of AC-stem 5') +AC_LOOP_RADIUS = 13.0 + +# --- variable-arm detection -------------------------------------------- + +# A sprinzl label like "e1", "e12", "e23" indicates a variable-arm position; +# these tRNAs (Leu, Ser, SeC, some Tyr/Thr) have an extended variable arm +# that the v1 elbow layout does not handle. Skip them. +VAR_ARM_RE = re.compile(r"^e\d") + + +def main() -> int: + total_written = 0 + total_skipped = 0 + + for org_dirname, sprinzl_fname in ORG_SPRINZL.items(): + org_dir = STRUCTURES_DIR / org_dirname + if not org_dir.is_dir(): + print(f" SKIP {org_dirname}: structures dir not found") + continue + + sprinzl_path = SPRINZL_DIR / sprinzl_fname + if not sprinzl_path.exists(): + print(f" SKIP {org_dirname}: sprinzl file not found at {sprinzl_path}") + continue + + print(f"\n=== {org_dirname} ===") + sprinzl = load_sprinzl(sprinzl_path) + out_dir = org_dir / "elbow" + out_dir.mkdir(parents=True, exist_ok=True) + + # Clean stale output + for old in out_dir.glob("*.svg"): + old.unlink() + for old in out_dir.glob("*.json"): + old.unlink() + + for json_path in sorted(org_dir.glob("*.json")): + trna_name = json_path.stem + try: + metadata = json.loads(json_path.read_text()) + except Exception as e: + print(f" ERROR reading {trna_name}: {e}") + continue + + sprinzl_rows = lookup_sprinzl(sprinzl, trna_name) + if sprinzl_rows is None: + print(f" SKIP {trna_name}: no Sprinzl mapping found") + total_skipped += 1 + continue + + if any(VAR_ARM_RE.match(r["sprinzl_label"]) for r in sprinzl_rows): + print(f" SKIP {trna_name}: variable-arm tRNA (deferred to v2)") + total_skipped += 1 + continue + + try: + elbow_meta = build_elbow(metadata, sprinzl_rows, trna_name) + except KeyError as e: + print(f" SKIP {trna_name}: missing layout key {e}") + total_skipped += 1 + continue + + svg_path = out_dir / f"{trna_name}.svg" + elbow_json_path = out_dir / f"{trna_name}.json" + svg_path.write_text(render_svg(elbow_meta, trna_name)) + elbow_json_path.write_text(json.dumps(elbow_meta, indent=2)) + n = len(elbow_meta["nucleotides"]) + print(f" OK {trna_name} ({n} nt)") + total_written += 1 + + print(f"\nWrote {total_written} elbow tRNA(s); skipped {total_skipped}.") + return 0 + + +# --- Sprinzl loading + lookup ------------------------------------------ + + +def load_sprinzl(path: Path) -> dict[str, list[dict]]: + """Group Sprinzl rows by trna_id.""" + by_id: dict[str, list[dict]] = {} + with gzip.open(path, "rt") as f: + reader = csv.DictReader(f, delimiter="\t") + for row in reader: + tid = row["trna_id"] + try: + row["seq_index"] = int(row["seq_index"]) + except (KeyError, ValueError): + continue + by_id.setdefault(tid, []).append(row) + return by_id + + +def lookup_sprinzl( + sprinzl: dict[str, list[dict]], trna_name: str +) -> list[dict] | None: + """Find a Sprinzl row block whose trna_id matches the structure name. + + Structure names use DNA anticodon notation (e.g., 'tRNA-Asp-GTC') while + Sprinzl files use RNA notation ('tRNA-Asp-GUC'). Convert T→U in the + anticodon segment before matching. + """ + rna_name = dna_to_rna_anticodon(trna_name) + + candidates = [ + tid for tid in sprinzl + if tid == rna_name or tid.startswith(rna_name + "-") + ] + if not candidates: + return None + candidates.sort() + rows = sprinzl[candidates[0]] + rows.sort(key=lambda r: r["seq_index"]) + return rows + + +def dna_to_rna_anticodon(trna_name: str) -> str: + m = re.match(r"^(tRNA-[A-Za-z0-9]+)-([ACGTU]+)$", trna_name) + if not m: + return trna_name + aa, codon = m.group(1), m.group(2) + return f"{aa}-{codon.replace('T', 'U')}" + + +# --- elbow geometry ----------------------------------------------------- + + +def build_elbow( + cloverleaf_meta: dict, sprinzl_rows: list[dict], trna_name: str +) -> dict: + """Compute elbow (x, y) for each nucleotide from its Sprinzl label. + + The cloverleaf metadata gives us the per-position bases and base-pair + line list (which we recompute against the new coords). The Sprinzl + rows give us the Sprinzl label and region per position. We index + nucleotides in the cloverleaf JSON by `pos` (1-based, document order) + and join to Sprinzl rows by `seq_index`. + """ + base_by_pos = {nuc["pos"]: nuc["base"] for nuc in cloverleaf_meta["nucleotides"]} + sprinzl_by_pos = {r["seq_index"]: r for r in sprinzl_rows} + + coord_table = elbow_coord_table() + + nucleotides = [] + pos_to_xy: dict[int, tuple[float, float]] = {} + for pos in sorted(base_by_pos.keys()): + spr = sprinzl_by_pos.get(pos) + if spr is None: + raise KeyError(f"pos {pos} missing from Sprinzl rows") + label = spr["sprinzl_label"] + if label not in coord_table: + raise KeyError(f"label {label!r} (pos {pos})") + x, y = coord_table[label] + pos_to_xy[pos] = (x, y) + nucleotides.append({ + "base": base_by_pos[pos], + "x": round(x, 2), + "y": round(y, 2), + "pos": pos, + }) + + lines = build_pair_lines(sprinzl_by_pos, pos_to_xy) + + xs = [n["x"] for n in nucleotides] + ys = [n["y"] for n in nucleotides] + width = round(max(xs) + 20, 2) + height = round(max(ys) + 20, 2) + + return { + "nucleotides": nucleotides, + "width": width, + "height": height, + "lines": lines, + "trna_name": trna_name, + "sequence": cloverleaf_meta.get("sequence", ""), + "structure": cloverleaf_meta.get("structure", ""), + } + + +def elbow_coord_table() -> dict[str, tuple[float, float]]: + """Sprinzl label -> (x, y) for the elbow layout. + + Top combined helix: + Top row (3' strand, continuous backbone L->R): + 61 62 63 64 65 66 67 68 69 70 71 72 + Bottom row (5' strand, with gap between T-stem and acceptor): + 53 52 51 50 49 [GAP] 7 6 5 4 3 2 1 + Pair vertically: 1<->72, 2<->71, ... 7<->66; 49<->65, 50<->64, ... 53<->61. + + T-loop (54..60) curls at far LEFT of the combined helix. + D-arm sits BELOW the top stack, horizontal, with D-loop at far LEFT. + AC-arm hangs DOWN below the rest, with AC-loop at the BOTTOM. + Variable region (44..48) curves from the right of the AC-stem 3' end + UP and OVER to position 49 on the top stack. + Discriminator + CCA (73..76) extend UP from pos 72 (top-right). + """ + coords: dict[str, tuple[float, float]] = {} + + # ----- acceptor stem (1..7 bottom row, 66..72 top row) ----- + for n in range(1, 8): + x = ACC_X1 - (n - 1) * S + coords[str(n)] = (x, BOT_Y) + for n in range(66, 73): + x = ACC_X1 - (72 - n) * S + coords[str(n)] = (x, TOP_Y) + + # rightmost / leftmost x of acceptor section + acc_left_x = ACC_X1 - 6 * S # x of pos 7 / pos 66 + t_right_x = acc_left_x - GAP # x of pos 49 / pos 65 (across the gap) + + # ----- T-stem (49..53 bottom row, 61..65 top row) ----- + for n in range(49, 54): + x = t_right_x - (n - 49) * S + coords[str(n)] = (x, BOT_Y) + for n in range(61, 66): + x = t_right_x - (65 - n) * S + coords[str(n)] = (x, TOP_Y) + + t_left_x = t_right_x - 4 * S # x of pos 53 / pos 61 + + # ----- T-loop (54..60), 7 residues on a 180° arc curling LEFT ----- + arc_cx = t_left_x - T_LOOP_RADIUS * 0.35 + arc_cy = (TOP_Y + BOT_Y) / 2 + for k, n in enumerate(range(54, 61)): + # k = 0..6, sweep from "just past pos 53" (bottom) up & around to + # "just before pos 61" (top). In SVG y-down: angle pi/2 = down, + # angle 3pi/2 = up; sweeping through pi (left). + t = (k + 0.5) / 7 # 1/14, 3/14, ..., 13/14 + theta = math.pi / 2 + t * math.pi + x = arc_cx + T_LOOP_RADIUS * math.cos(theta) + y = arc_cy + T_LOOP_RADIUS * math.sin(theta) + coords[str(n)] = (x, y) + + # ----- discriminator + CCA (73..76) extend UP from pos 72 ----- + cca_x = ACC_X1 + for k, n in enumerate(range(73, 77)): + # 73 just above 72 on the same column, 74-76 stacking up + coords[str(n)] = (cca_x, TOP_Y - (k + 1) * S) + + # ----- D-arm: horizontal stem, D-loop curls LEFT ----- + # D-arm shifted LEFT of pos 7 so the variable-region curve from AC-stem 3' + # up to pos 49 does not collide with the D-stem on the right end. + # Hinge 8, 9 carry the backbone diagonally LEFT-and-DOWN from pos 7 to + # pos 10 (the junction-side end of D-stem 5'). + d_anchor_x = acc_left_x - 2 * S # x of pos 10 + coords["8"] = ( + acc_left_x - 0.4 * S, + BOT_Y + (D_TOP_Y - BOT_Y) * 0.4, + ) + coords["9"] = ( + acc_left_x - 1.3 * S, + BOT_Y + (D_TOP_Y - BOT_Y) * 0.8, + ) + for n in range(10, 14): + x = d_anchor_x - (n - 10) * S + coords[str(n)] = (x, D_TOP_Y) + for n in range(22, 26): + # pair: 22-13, 23-12, 24-11, 25-10 + # so pos 25 at d_anchor_x (paired with 10), pos 22 at d_anchor_x - 3*S (paired with 13) + x = d_anchor_x - (25 - n) * S + coords[str(n)] = (x, D_BOT_Y) + + d_loop_left_x = d_anchor_x - 3 * S # x of pos 13 / pos 22 + + # ----- D-loop (14..21), 8 residues on 180° arc curling LEFT ----- + # Some tRNAs include 17a, 20a, 20b insertions; we'll handle those by + # adding labels at interpolated positions below. + arc_cx_d = d_loop_left_x - D_LOOP_RADIUS * 0.35 + arc_cy_d = (D_TOP_Y + D_BOT_Y) / 2 + for k, n in enumerate(range(14, 22)): + t = (k + 0.5) / 8 + theta = math.pi / 2 + t * math.pi + x = arc_cx_d + D_LOOP_RADIUS * math.cos(theta) + y = arc_cy_d + D_LOOP_RADIUS * math.sin(theta) + coords[str(n)] = (x, y) + + # D-loop insertions: 17a is between 17 and 18; 20a between 20 and 21; + # 20b between 20a and 21. Place them on the same arc with offset t. + # (Sprinzl insertion convention: 17a immediately follows 17 in sequence.) + # We compute approximate t-values to keep the loop visually balanced. + insertion_ts = { + "17a": (3.5 + 0.5) / 8, # between 17 (k=3) and 18 (k=4) + "20a": (6.3 + 0.5) / 8, # between 20 (k=6) and 21 (k=7) + "20b": (6.6 + 0.5) / 8, + } + for label, t in insertion_ts.items(): + theta = math.pi / 2 + t * math.pi + x = arc_cx_d + D_LOOP_RADIUS * math.cos(theta) + y = arc_cy_d + D_LOOP_RADIUS * math.sin(theta) + coords[label] = (x, y) + + # ----- pos 26 (hinge between D-stem 3' and AC-stem 5') ----- + # diagonal from pos 25 (d_anchor_x, D_BOT_Y) to pos 27 (AC_X_LEFT, AC_TOP_Y). + coords["26"] = ( + d_anchor_x - (d_anchor_x - AC_X_LEFT) * 0.55, + D_BOT_Y + (AC_TOP_Y - D_BOT_Y) * 0.55, + ) + + # ----- anticodon stem (27..31 left col, 39..43 right col) ----- + # Pairs: 27-43, 28-42, 29-41, 30-40, 31-39 + # 27 at top-left of AC-arm, 31 at bottom-left (just above AC-loop). + for n in range(27, 32): + y = AC_TOP_Y + (n - 27) * S + coords[str(n)] = (AC_X_LEFT, y) + for n in range(39, 44): + # 43 at top-right (paired with 27); 39 at bottom-right (paired with 31) + y = AC_TOP_Y + (43 - n) * S + coords[str(n)] = (AC_X_RIGHT, y) + + ac_bot_y = AC_TOP_Y + 4 * S # y of pos 31 / pos 39 + + # ----- AC-loop (32..38), 7 residues on 180° arc curling DOWN ----- + arc_cx_ac = (AC_X_LEFT + AC_X_RIGHT) / 2 + arc_cy_ac = ac_bot_y + AC_LOOP_RADIUS * 0.35 + for k, n in enumerate(range(32, 39)): + t = (k + 0.5) / 7 + # sweep from angle pi (left, near pos 31 column) to 0 (right, near pos 39 column) + # going DOWN through 3pi/2 (in y-down convention, that's bottom). + # parameterize: theta = pi - t * pi (pi to 0) + # but we want the arc to bulge DOWNWARD (positive y in SVG) + theta = math.pi - t * math.pi + x = arc_cx_ac + AC_LOOP_RADIUS * math.cos(theta) + # bulge down: use abs(sin) so all loop residues have y > arc_cy_ac + y = arc_cy_ac + AC_LOOP_RADIUS * abs(math.sin(theta)) + coords[str(n)] = (x, y) + + # ----- variable region (44..48): smooth curve from AC-stem 3' top to pos 49 ----- + # AC_X_LEFT was chosen so AC-arm sits roughly under the elbow region of the + # top stack; the variable region is then a bulge from pos 43 (top-right of + # AC-stem) up to pos 49 (T-stem 5' end on bottom row of top stack). The + # bezier control point is pushed well to the RIGHT so the path bows away + # from the AC-stem 3' column rather than overlapping it. + var_start = (AC_X_RIGHT, AC_TOP_Y - 0.7 * S) + var_end = (t_right_x - 0.3 * S, BOT_Y + 0.6 * S) + ctrl_x = max(var_start[0], var_end[0]) + 22 + ctrl_y = (var_start[1] + var_end[1]) / 2 + for k, n in enumerate(range(44, 49)): + t = (k + 0.5) / 5 + x = (1 - t) ** 2 * var_start[0] + 2 * (1 - t) * t * ctrl_x + t ** 2 * var_end[0] + y = (1 - t) ** 2 * var_start[1] + 2 * (1 - t) * t * ctrl_y + t ** 2 * var_end[1] + coords[str(n)] = (x, y) + + return coords + + +def build_pair_lines( + sprinzl_by_pos: dict[int, dict], + pos_to_xy: dict[int, tuple[float, float]], +) -> list[dict]: + """Compute base-pair tick lines from Sprinzl pairings.""" + label_to_pos: dict[str, int] = {} + for pos, row in sprinzl_by_pos.items(): + label = row["sprinzl_label"] + label_to_pos.setdefault(label, pos) + + canonical_pairs = [ + # acceptor stem + ("1", "72"), ("2", "71"), ("3", "70"), ("4", "69"), + ("5", "68"), ("6", "67"), ("7", "66"), + # D-stem + ("10", "25"), ("11", "24"), ("12", "23"), ("13", "22"), + # AC-stem + ("27", "43"), ("28", "42"), ("29", "41"), + ("30", "40"), ("31", "39"), + # T-stem + ("49", "65"), ("50", "64"), ("51", "63"), + ("52", "62"), ("53", "61"), + ] + + lines: list[dict] = [] + for a, b in canonical_pairs: + pa, pb = label_to_pos.get(a), label_to_pos.get(b) + if pa is None or pb is None: + continue + xa, ya = pos_to_xy[pa] + xb, yb = pos_to_xy[pb] + # base-pair tick: short segment between the two paired letter centers, + # offset so it doesn't overlap the letters. + dx, dy = xb - xa, yb - ya + L = math.hypot(dx, dy) + if L < 1e-6: + continue + ux, uy = dx / L, dy / L + pad = 2.5 + x1 = xa + ux * pad + y1 = ya + uy * pad + x2 = xb - ux * pad + y2 = yb - uy * pad + # add small character-center offset (matches plot-structure.R nuc_*_offset) + x1 += 2.375 + y1 += -2.565 + x2 += 2.375 + y2 += -2.565 + lines.append({ + "x1": round(x1, 2), + "y1": round(y1, 2), + "x2": round(x2, 2), + "y2": round(y2, 2), + }) + return lines + + +# --- SVG rendering ------------------------------------------------------ + + +SVG_HEADER = """ + + {name} + +""" + +NUC_TEXT = ( + '\n' + ' {base}\n' + '\n' +) + +PAIR_PATH = ( + '\n' +) + + +def render_svg(meta: dict, trna_name: str) -> str: + parts = [SVG_HEADER.format(w=meta["width"], h=meta["height"], name=trna_name)] + for line in meta["lines"]: + parts.append(PAIR_PATH.format(**{ + "x1": line["x1"], "y1": line["y1"], + "x2": line["x2"], "y2": line["y2"], + })) + for nuc in meta["nucleotides"]: + parts.append(NUC_TEXT.format(x=nuc["x"], y=nuc["y"], base=nuc["base"])) + parts.append("\n") + return "".join(parts) + + +if __name__ == "__main__": + sys.exit(main()) diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.json new file mode 100644 index 0000000..0eb55e2 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.json @@ -0,0 +1,593 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "G", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "G", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "G", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "C", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "U", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "A", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "C", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "U", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 18 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 19 + }, + { + "base": "G", + "x": 100.97, + "y": 54.36, + "pos": 20 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 21 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 22 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 23 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 24 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 25 + }, + { + "base": "G", + "x": 133.13, + "y": 80.22, + "pos": 26 + }, + { + "base": "C", + "x": 132.0, + "y": 90.12, + "pos": 27 + }, + { + "base": "U", + "x": 132.0, + "y": 97.68, + "pos": 28 + }, + { + "base": "U", + "x": 132.0, + "y": 105.24, + "pos": 29 + }, + { + "base": "G", + "x": 132.0, + "y": 112.8, + "pos": 30 + }, + { + "base": "C", + "x": 132.0, + "y": 120.36, + "pos": 31 + }, + { + "base": "A", + "x": 123.11, + "y": 127.8, + "pos": 32 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 33 + }, + { + "base": "G", + "x": 130.14, + "y": 136.62, + "pos": 34 + }, + { + "base": "G", + "x": 135.78, + "y": 137.91, + "pos": 35 + }, + { + "base": "C", + "x": 141.42, + "y": 136.62, + "pos": 36 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 37 + }, + { + "base": "U", + "x": 148.45, + "y": 127.8, + "pos": 38 + }, + { + "base": "G", + "x": 139.56, + "y": 120.36, + "pos": 39 + }, + { + "base": "C", + "x": 139.56, + "y": 112.8, + "pos": 40 + }, + { + "base": "A", + "x": 139.56, + "y": 105.24, + "pos": 41 + }, + { + "base": "A", + "x": 139.56, + "y": 97.68, + "pos": 42 + }, + { + "base": "G", + "x": 139.56, + "y": 90.12, + "pos": 43 + }, + { + "base": "A", + "x": 143.49, + "y": 81.05, + "pos": 44 + }, + { + "base": "G", + "x": 148.55, + "y": 73.51, + "pos": 45 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 46 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 47 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 48 + }, + { + "base": "A", + "x": 139.06, + "y": 42.56, + "pos": 49 + }, + { + "base": "G", + "x": 131.5, + "y": 42.56, + "pos": 50 + }, + { + "base": "C", + "x": 123.94, + "y": 42.56, + "pos": 51 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 53 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 54 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 55 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 56 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 57 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 58 + }, + { + "base": "U", + "x": 96.16, + "y": 28.62, + "pos": 59 + }, + { + "base": "C", + "x": 101.37, + "y": 26.11, + "pos": 60 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 61 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 62 + }, + { + "base": "G", + "x": 123.94, + "y": 35.0, + "pos": 63 + }, + { + "base": "C", + "x": 131.5, + "y": 35.0, + "pos": 64 + }, + { + "base": "U", + "x": 139.06, + "y": 35.0, + "pos": 65 + }, + { + "base": "U", + "x": 149.64, + "y": 35.0, + "pos": 66 + }, + { + "base": "A", + "x": 157.2, + "y": 35.0, + "pos": 67 + }, + { + "base": "G", + "x": 164.76, + "y": 35.0, + "pos": 68 + }, + { + "base": "C", + "x": 172.32, + "y": 35.0, + "pos": 69 + }, + { + "base": "U", + "x": 179.88, + "y": 35.0, + "pos": 70 + }, + { + "base": "C", + "x": 187.44, + "y": 35.0, + "pos": 71 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 72 + }, + { + "base": "A", + "x": 195.0, + "y": 27.44, + "pos": 73 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 75 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 76 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Ala-GGC", + "sequence": "GGGGCUAUAGCUCAGCUGGGAGAGCGCUUGCAUGGCAUGCAAGAGGUCAGCGGUUCGAUCCCGCUUAGCUCCACCA", + "structure": "<<<<<<<..<<<<........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.svg new file mode 100644 index 0000000..0ea9bf4 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.svg @@ -0,0 +1,261 @@ + + + tRNA-Ala-GGC + + + + + + + + + + + + + + + + + + + + + + + + G + + + G + + + G + + + G + + + C + + + U + + + A + + + U + + + A + + + G + + + C + + + U + + + C + + + A + + + G + + + C + + + U + + + G + + + G + + + G + + + A + + + G + + + A + + + G + + + C + + + G + + + C + + + U + + + U + + + G + + + C + + + A + + + U + + + G + + + G + + + C + + + A + + + U + + + G + + + C + + + A + + + A + + + G + + + A + + + G + + + G + + + U + + + C + + + A + + + G + + + C + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + U + + + C + + + C + + + C + + + G + + + C + + + U + + + U + + + A + + + G + + + C + + + U + + + C + + + C + + + A + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.json new file mode 100644 index 0000000..a2457be --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.json @@ -0,0 +1,593 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "G", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "G", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "G", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "C", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "U", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "A", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "C", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "U", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 18 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 19 + }, + { + "base": "G", + "x": 100.97, + "y": 54.36, + "pos": 20 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 21 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 22 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 23 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 24 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 25 + }, + { + "base": "G", + "x": 133.13, + "y": 80.22, + "pos": 26 + }, + { + "base": "C", + "x": 132.0, + "y": 90.12, + "pos": 27 + }, + { + "base": "C", + "x": 132.0, + "y": 97.68, + "pos": 28 + }, + { + "base": "U", + "x": 132.0, + "y": 105.24, + "pos": 29 + }, + { + "base": "G", + "x": 132.0, + "y": 112.8, + "pos": 30 + }, + { + "base": "C", + "x": 132.0, + "y": 120.36, + "pos": 31 + }, + { + "base": "U", + "x": 123.11, + "y": 127.8, + "pos": 32 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 33 + }, + { + "base": "U", + "x": 130.14, + "y": 136.62, + "pos": 34 + }, + { + "base": "G", + "x": 135.78, + "y": 137.91, + "pos": 35 + }, + { + "base": "C", + "x": 141.42, + "y": 136.62, + "pos": 36 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 37 + }, + { + "base": "C", + "x": 148.45, + "y": 127.8, + "pos": 38 + }, + { + "base": "G", + "x": 139.56, + "y": 120.36, + "pos": 39 + }, + { + "base": "C", + "x": 139.56, + "y": 112.8, + "pos": 40 + }, + { + "base": "A", + "x": 139.56, + "y": 105.24, + "pos": 41 + }, + { + "base": "G", + "x": 139.56, + "y": 97.68, + "pos": 42 + }, + { + "base": "G", + "x": 139.56, + "y": 90.12, + "pos": 43 + }, + { + "base": "A", + "x": 143.49, + "y": 81.05, + "pos": 44 + }, + { + "base": "G", + "x": 148.55, + "y": 73.51, + "pos": 45 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 46 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 47 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 48 + }, + { + "base": "U", + "x": 139.06, + "y": 42.56, + "pos": 49 + }, + { + "base": "G", + "x": 131.5, + "y": 42.56, + "pos": 50 + }, + { + "base": "C", + "x": 123.94, + "y": 42.56, + "pos": 51 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 53 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 54 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 55 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 56 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 57 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 58 + }, + { + "base": "U", + "x": 96.16, + "y": 28.62, + "pos": 59 + }, + { + "base": "C", + "x": 101.37, + "y": 26.11, + "pos": 60 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 61 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 62 + }, + { + "base": "G", + "x": 123.94, + "y": 35.0, + "pos": 63 + }, + { + "base": "C", + "x": 131.5, + "y": 35.0, + "pos": 64 + }, + { + "base": "A", + "x": 139.06, + "y": 35.0, + "pos": 65 + }, + { + "base": "U", + "x": 149.64, + "y": 35.0, + "pos": 66 + }, + { + "base": "A", + "x": 157.2, + "y": 35.0, + "pos": 67 + }, + { + "base": "G", + "x": 164.76, + "y": 35.0, + "pos": 68 + }, + { + "base": "C", + "x": 172.32, + "y": 35.0, + "pos": 69 + }, + { + "base": "U", + "x": 179.88, + "y": 35.0, + "pos": 70 + }, + { + "base": "C", + "x": 187.44, + "y": 35.0, + "pos": 71 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 72 + }, + { + "base": "A", + "x": 195.0, + "y": 27.44, + "pos": 73 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 75 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 76 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Ala-TGC", + "sequence": "GGGGCUAUAGCUCAGCUGGGAGAGCGCCUGCUUUGCACGCAGGAGGUCUGCGGUUCGAUCCCGCAUAGCUCCACCA", + "structure": "<<<<<<<..<<<<........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.svg new file mode 100644 index 0000000..7e391b1 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.svg @@ -0,0 +1,261 @@ + + + tRNA-Ala-TGC + + + + + + + + + + + + + + + + + + + + + + + + G + + + G + + + G + + + G + + + C + + + U + + + A + + + U + + + A + + + G + + + C + + + U + + + C + + + A + + + G + + + C + + + U + + + G + + + G + + + G + + + A + + + G + + + A + + + G + + + C + + + G + + + C + + + C + + + U + + + G + + + C + + + U + + + U + + + U + + + G + + + C + + + A + + + C + + + G + + + C + + + A + + + G + + + G + + + A + + + G + + + G + + + U + + + C + + + U + + + G + + + C + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + U + + + C + + + C + + + C + + + G + + + C + + + A + + + U + + + A + + + G + + + C + + + U + + + C + + + C + + + A + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.json new file mode 100644 index 0000000..d9ca253 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.json @@ -0,0 +1,599 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "C", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "A", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "U", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "C", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "C", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "G", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "C", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "U", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 18 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 19 + }, + { + "base": "A", + "x": 100.97, + "y": 54.36, + "pos": 20 + }, + { + "base": "U", + "x": 102.19, + "y": 53.65, + "pos": 21 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 22 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 23 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 24 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 25 + }, + { + "base": "U", + "x": 134.52, + "y": 68.12, + "pos": 26 + }, + { + "base": "A", + "x": 133.13, + "y": 80.22, + "pos": 27 + }, + { + "base": "C", + "x": 132.0, + "y": 90.12, + "pos": 28 + }, + { + "base": "U", + "x": 132.0, + "y": 97.68, + "pos": 29 + }, + { + "base": "C", + "x": 132.0, + "y": 105.24, + "pos": 30 + }, + { + "base": "G", + "x": 132.0, + "y": 112.8, + "pos": 31 + }, + { + "base": "G", + "x": 132.0, + "y": 120.36, + "pos": 32 + }, + { + "base": "C", + "x": 123.11, + "y": 127.8, + "pos": 33 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 34 + }, + { + "base": "A", + "x": 130.14, + "y": 136.62, + "pos": 35 + }, + { + "base": "C", + "x": 135.78, + "y": 137.91, + "pos": 36 + }, + { + "base": "G", + "x": 141.42, + "y": 136.62, + "pos": 37 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 38 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 39 + }, + { + "base": "C", + "x": 139.56, + "y": 120.36, + "pos": 40 + }, + { + "base": "C", + "x": 139.56, + "y": 112.8, + "pos": 41 + }, + { + "base": "G", + "x": 139.56, + "y": 105.24, + "pos": 42 + }, + { + "base": "A", + "x": 139.56, + "y": 97.68, + "pos": 43 + }, + { + "base": "G", + "x": 139.56, + "y": 90.12, + "pos": 44 + }, + { + "base": "C", + "x": 143.49, + "y": 81.05, + "pos": 45 + }, + { + "base": "G", + "x": 148.55, + "y": 73.51, + "pos": 46 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 47 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 48 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 49 + }, + { + "base": "G", + "x": 139.06, + "y": 42.56, + "pos": 50 + }, + { + "base": "G", + "x": 131.5, + "y": 42.56, + "pos": 51 + }, + { + "base": "A", + "x": 123.94, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 53 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 54 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 55 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 56 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 57 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 58 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 59 + }, + { + "base": "A", + "x": 96.16, + "y": 28.62, + "pos": 60 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 61 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 62 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 63 + }, + { + "base": "U", + "x": 123.94, + "y": 35.0, + "pos": 64 + }, + { + "base": "C", + "x": 131.5, + "y": 35.0, + "pos": 65 + }, + { + "base": "C", + "x": 139.06, + "y": 35.0, + "pos": 66 + }, + { + "base": "C", + "x": 149.64, + "y": 35.0, + "pos": 67 + }, + { + "base": "G", + "x": 157.2, + "y": 35.0, + "pos": 68 + }, + { + "base": "G", + "x": 164.76, + "y": 35.0, + "pos": 69 + }, + { + "base": "A", + "x": 172.32, + "y": 35.0, + "pos": 70 + }, + { + "base": "U", + "x": 179.88, + "y": 35.0, + "pos": 71 + }, + { + "base": "G", + "x": 187.44, + "y": 35.0, + "pos": 72 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 73 + }, + { + "base": "A", + "x": 195.0, + "y": 27.44, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 75 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 76 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 77 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Arg-ACG", + "sequence": "GCAUCCGUAGCUCAGCUGGAUAGAGUACUCGGCUACGAACCGAGCGGUCGGAGGUUCGAAUCCUCCCGGAUGCACCA", + "structure": "<<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.svg new file mode 100644 index 0000000..b995f79 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.svg @@ -0,0 +1,264 @@ + + + tRNA-Arg-ACG + + + + + + + + + + + + + + + + + + + + + + + + G + + + C + + + A + + + U + + + C + + + C + + + G + + + U + + + A + + + G + + + C + + + U + + + C + + + A + + + G + + + C + + + U + + + G + + + G + + + A + + + U + + + A + + + G + + + A + + + G + + + U + + + A + + + C + + + U + + + C + + + G + + + G + + + C + + + U + + + A + + + C + + + G + + + A + + + A + + + C + + + C + + + G + + + A + + + G + + + C + + + G + + + G + + + U + + + C + + + G + + + G + + + A + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + A + + + U + + + C + + + C + + + U + + + C + + + C + + + C + + + G + + + G + + + A + + + U + + + G + + + C + + + A + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.json new file mode 100644 index 0000000..301981a --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.json @@ -0,0 +1,599 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "C", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "G", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "C", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "C", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "C", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "G", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "C", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "U", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 18 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 19 + }, + { + "base": "A", + "x": 100.97, + "y": 54.36, + "pos": 20 + }, + { + "base": "U", + "x": 102.19, + "y": 53.65, + "pos": 21 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 22 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 23 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 24 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 25 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 26 + }, + { + "base": "G", + "x": 133.13, + "y": 80.22, + "pos": 27 + }, + { + "base": "C", + "x": 132.0, + "y": 90.12, + "pos": 28 + }, + { + "base": "U", + "x": 132.0, + "y": 97.68, + "pos": 29 + }, + { + "base": "G", + "x": 132.0, + "y": 105.24, + "pos": 30 + }, + { + "base": "C", + "x": 132.0, + "y": 112.8, + "pos": 31 + }, + { + "base": "C", + "x": 132.0, + "y": 120.36, + "pos": 32 + }, + { + "base": "C", + "x": 123.11, + "y": 127.8, + "pos": 33 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 34 + }, + { + "base": "C", + "x": 130.14, + "y": 136.62, + "pos": 35 + }, + { + "base": "C", + "x": 135.78, + "y": 137.91, + "pos": 36 + }, + { + "base": "G", + "x": 141.42, + "y": 136.62, + "pos": 37 + }, + { + "base": "G", + "x": 145.94, + "y": 133.02, + "pos": 38 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 39 + }, + { + "base": "G", + "x": 139.56, + "y": 120.36, + "pos": 40 + }, + { + "base": "G", + "x": 139.56, + "y": 112.8, + "pos": 41 + }, + { + "base": "C", + "x": 139.56, + "y": 105.24, + "pos": 42 + }, + { + "base": "A", + "x": 139.56, + "y": 97.68, + "pos": 43 + }, + { + "base": "G", + "x": 139.56, + "y": 90.12, + "pos": 44 + }, + { + "base": "A", + "x": 143.49, + "y": 81.05, + "pos": 45 + }, + { + "base": "G", + "x": 148.55, + "y": 73.51, + "pos": 46 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 47 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 48 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 49 + }, + { + "base": "U", + "x": 139.06, + "y": 42.56, + "pos": 50 + }, + { + "base": "C", + "x": 131.5, + "y": 42.56, + "pos": 51 + }, + { + "base": "A", + "x": 123.94, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 53 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 54 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 55 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 56 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 57 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 58 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 59 + }, + { + "base": "A", + "x": 96.16, + "y": 28.62, + "pos": 60 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 61 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 62 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 63 + }, + { + "base": "U", + "x": 123.94, + "y": 35.0, + "pos": 64 + }, + { + "base": "G", + "x": 131.5, + "y": 35.0, + "pos": 65 + }, + { + "base": "U", + "x": 139.06, + "y": 35.0, + "pos": 66 + }, + { + "base": "C", + "x": 149.64, + "y": 35.0, + "pos": 67 + }, + { + "base": "G", + "x": 157.2, + "y": 35.0, + "pos": 68 + }, + { + "base": "G", + "x": 164.76, + "y": 35.0, + "pos": 69 + }, + { + "base": "G", + "x": 172.32, + "y": 35.0, + "pos": 70 + }, + { + "base": "C", + "x": 179.88, + "y": 35.0, + "pos": 71 + }, + { + "base": "G", + "x": 187.44, + "y": 35.0, + "pos": 72 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 73 + }, + { + "base": "G", + "x": 195.0, + "y": 27.44, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 75 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 76 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 77 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Arg-CCG", + "sequence": "GCGCCCGUAGCUCAGCUGGAUAGAGCGCUGCCCUCCGGAGGCAGAGGUCUCAGGUUCGAAUCCUGUCGGGCGCGCCA", + "structure": "<<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.svg new file mode 100644 index 0000000..5e52209 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.svg @@ -0,0 +1,264 @@ + + + tRNA-Arg-CCG + + + + + + + + + + + + + + + + + + + + + + + + G + + + C + + + G + + + C + + + C + + + C + + + G + + + U + + + A + + + G + + + C + + + U + + + C + + + A + + + G + + + C + + + U + + + G + + + G + + + A + + + U + + + A + + + G + + + A + + + G + + + C + + + G + + + C + + + U + + + G + + + C + + + C + + + C + + + U + + + C + + + C + + + G + + + G + + + A + + + G + + + G + + + C + + + A + + + G + + + A + + + G + + + G + + + U + + + C + + + U + + + C + + + A + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + A + + + U + + + C + + + C + + + U + + + G + + + U + + + C + + + G + + + G + + + G + + + C + + + G + + + C + + + G + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.json new file mode 100644 index 0000000..4e44498 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.json @@ -0,0 +1,587 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "U", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "C", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "C", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "U", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "C", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "U", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "U", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "A", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "A", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "U", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 17 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 18 + }, + { + "base": "A", + "x": 100.97, + "y": 54.36, + "pos": 19 + }, + { + "base": "U", + "x": 102.19, + "y": 53.65, + "pos": 20 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 21 + }, + { + "base": "U", + "x": 111.84, + "y": 68.12, + "pos": 22 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 23 + }, + { + "base": "A", + "x": 126.96, + "y": 68.12, + "pos": 24 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 25 + }, + { + "base": "G", + "x": 133.13, + "y": 80.22, + "pos": 26 + }, + { + "base": "A", + "x": 132.0, + "y": 90.12, + "pos": 27 + }, + { + "base": "G", + "x": 132.0, + "y": 97.68, + "pos": 28 + }, + { + "base": "C", + "x": 132.0, + "y": 105.24, + "pos": 29 + }, + { + "base": "C", + "x": 132.0, + "y": 112.8, + "pos": 30 + }, + { + "base": "C", + "x": 132.0, + "y": 120.36, + "pos": 31 + }, + { + "base": "C", + "x": 123.11, + "y": 127.8, + "pos": 32 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 33 + }, + { + "base": "C", + "x": 130.14, + "y": 136.62, + "pos": 34 + }, + { + "base": "C", + "x": 135.78, + "y": 137.91, + "pos": 35 + }, + { + "base": "U", + "x": 141.42, + "y": 136.62, + "pos": 36 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 37 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 38 + }, + { + "base": "G", + "x": 139.56, + "y": 120.36, + "pos": 39 + }, + { + "base": "G", + "x": 139.56, + "y": 112.8, + "pos": 40 + }, + { + "base": "G", + "x": 139.56, + "y": 105.24, + "pos": 41 + }, + { + "base": "C", + "x": 139.56, + "y": 97.68, + "pos": 42 + }, + { + "base": "U", + "x": 139.56, + "y": 90.12, + "pos": 43 + }, + { + "base": "A", + "x": 143.49, + "y": 81.05, + "pos": 44 + }, + { + "base": "A", + "x": 149.87, + "y": 65.96, + "pos": 45 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 46 + }, + { + "base": "U", + "x": 141.27, + "y": 50.87, + "pos": 47 + }, + { + "base": "G", + "x": 139.06, + "y": 42.56, + "pos": 48 + }, + { + "base": "C", + "x": 131.5, + "y": 42.56, + "pos": 49 + }, + { + "base": "A", + "x": 123.94, + "y": 42.56, + "pos": 50 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 51 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 52 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 53 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 54 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 55 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 56 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 57 + }, + { + "base": "U", + "x": 96.16, + "y": 28.62, + "pos": 58 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 59 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 60 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 61 + }, + { + "base": "U", + "x": 123.94, + "y": 35.0, + "pos": 62 + }, + { + "base": "G", + "x": 131.5, + "y": 35.0, + "pos": 63 + }, + { + "base": "C", + "x": 139.06, + "y": 35.0, + "pos": 64 + }, + { + "base": "A", + "x": 149.64, + "y": 35.0, + "pos": 65 + }, + { + "base": "G", + "x": 157.2, + "y": 35.0, + "pos": 66 + }, + { + "base": "G", + "x": 164.76, + "y": 35.0, + "pos": 67 + }, + { + "base": "G", + "x": 172.32, + "y": 35.0, + "pos": 68 + }, + { + "base": "G", + "x": 179.88, + "y": 35.0, + "pos": 69 + }, + { + "base": "A", + "x": 187.44, + "y": 35.0, + "pos": 70 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 71 + }, + { + "base": "A", + "x": 195.0, + "y": 27.44, + "pos": 72 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 73 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 74 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 75 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Arg-CCT", + "sequence": "GUCCUCUUAGUUAAAUGGAUAUAACGAGCCCCUCCUAAGGGCUAAUUGCAGGUUCGAUUCCUGCAGGGGACACCA", + "structure": "<<<<<<<..<<<<........>>>>.<<<<<.......>>>>>....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.svg new file mode 100644 index 0000000..ea38c23 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.svg @@ -0,0 +1,258 @@ + + + tRNA-Arg-CCT + + + + + + + + + + + + + + + + + + + + + + + + G + + + U + + + C + + + C + + + U + + + C + + + U + + + U + + + A + + + G + + + U + + + U + + + A + + + A + + + A + + + U + + + G + + + G + + + A + + + U + + + A + + + U + + + A + + + A + + + C + + + G + + + A + + + G + + + C + + + C + + + C + + + C + + + U + + + C + + + C + + + U + + + A + + + A + + + G + + + G + + + G + + + C + + + U + + + A + + + A + + + U + + + U + + + G + + + C + + + A + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + U + + + U + + + C + + + C + + + U + + + G + + + C + + + A + + + G + + + G + + + G + + + G + + + A + + + C + + + A + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.json new file mode 100644 index 0000000..75d60b7 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.json @@ -0,0 +1,599 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "C", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "G", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "C", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "C", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "C", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "U", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "U", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "U", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 18 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 19 + }, + { + "base": "A", + "x": 100.97, + "y": 54.36, + "pos": 20 + }, + { + "base": "U", + "x": 102.19, + "y": 53.65, + "pos": 21 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 22 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 23 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 24 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 25 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 26 + }, + { + "base": "A", + "x": 133.13, + "y": 80.22, + "pos": 27 + }, + { + "base": "A", + "x": 132.0, + "y": 90.12, + "pos": 28 + }, + { + "base": "C", + "x": 132.0, + "y": 97.68, + "pos": 29 + }, + { + "base": "G", + "x": 132.0, + "y": 105.24, + "pos": 30 + }, + { + "base": "A", + "x": 132.0, + "y": 112.8, + "pos": 31 + }, + { + "base": "C", + "x": 132.0, + "y": 120.36, + "pos": 32 + }, + { + "base": "C", + "x": 123.11, + "y": 127.8, + "pos": 33 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 34 + }, + { + "base": "U", + "x": 130.14, + "y": 136.62, + "pos": 35 + }, + { + "base": "C", + "x": 135.78, + "y": 137.91, + "pos": 36 + }, + { + "base": "U", + "x": 141.42, + "y": 136.62, + "pos": 37 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 38 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 39 + }, + { + "base": "G", + "x": 139.56, + "y": 120.36, + "pos": 40 + }, + { + "base": "U", + "x": 139.56, + "y": 112.8, + "pos": 41 + }, + { + "base": "C", + "x": 139.56, + "y": 105.24, + "pos": 42 + }, + { + "base": "G", + "x": 139.56, + "y": 97.68, + "pos": 43 + }, + { + "base": "U", + "x": 139.56, + "y": 90.12, + "pos": 44 + }, + { + "base": "G", + "x": 143.49, + "y": 81.05, + "pos": 45 + }, + { + "base": "G", + "x": 148.55, + "y": 73.51, + "pos": 46 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 47 + }, + { + "base": "C", + "x": 147.44, + "y": 58.42, + "pos": 48 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 49 + }, + { + "base": "G", + "x": 139.06, + "y": 42.56, + "pos": 50 + }, + { + "base": "C", + "x": 131.5, + "y": 42.56, + "pos": 51 + }, + { + "base": "A", + "x": 123.94, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 53 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 54 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 55 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 56 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 57 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 58 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 59 + }, + { + "base": "A", + "x": 96.16, + "y": 28.62, + "pos": 60 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 61 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 62 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 63 + }, + { + "base": "U", + "x": 123.94, + "y": 35.0, + "pos": 64 + }, + { + "base": "G", + "x": 131.5, + "y": 35.0, + "pos": 65 + }, + { + "base": "C", + "x": 139.06, + "y": 35.0, + "pos": 66 + }, + { + "base": "A", + "x": 149.64, + "y": 35.0, + "pos": 67 + }, + { + "base": "G", + "x": 157.2, + "y": 35.0, + "pos": 68 + }, + { + "base": "G", + "x": 164.76, + "y": 35.0, + "pos": 69 + }, + { + "base": "G", + "x": 172.32, + "y": 35.0, + "pos": 70 + }, + { + "base": "C", + "x": 179.88, + "y": 35.0, + "pos": 71 + }, + { + "base": "G", + "x": 187.44, + "y": 35.0, + "pos": 72 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 73 + }, + { + "base": "G", + "x": 195.0, + "y": 27.44, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 75 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 76 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 77 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Arg-TCT", + "sequence": "GCGCCCUUAGCUCAGUUGGAUAGAGCAACGACCUUCUAAGUCGUGGGCCGCAGGUUCGAAUCCUGCAGGGCGCGCCA", + "structure": "<<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.svg new file mode 100644 index 0000000..0a49ee7 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.svg @@ -0,0 +1,264 @@ + + + tRNA-Arg-TCT + + + + + + + + + + + + + + + + + + + + + + + + G + + + C + + + G + + + C + + + C + + + C + + + U + + + U + + + A + + + G + + + C + + + U + + + C + + + A + + + G + + + U + + + U + + + G + + + G + + + A + + + U + + + A + + + G + + + A + + + G + + + C + + + A + + + A + + + C + + + G + + + A + + + C + + + C + + + U + + + U + + + C + + + U + + + A + + + A + + + G + + + U + + + C + + + G + + + U + + + G + + + G + + + G + + + C + + + C + + + G + + + C + + + A + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + A + + + U + + + C + + + C + + + U + + + G + + + C + + + A + + + G + + + G + + + G + + + C + + + G + + + C + + + G + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.json new file mode 100644 index 0000000..de9205a --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.json @@ -0,0 +1,593 @@ +{ + "nucleotides": [ + { + "base": "U", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "C", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "C", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "U", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "C", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "U", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "G", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "U", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "U", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "C", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 18 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 19 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 20 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 21 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 22 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 23 + }, + { + "base": "A", + "x": 126.96, + "y": 68.12, + "pos": 24 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 25 + }, + { + "base": "G", + "x": 133.13, + "y": 80.22, + "pos": 26 + }, + { + "base": "G", + "x": 132.0, + "y": 90.12, + "pos": 27 + }, + { + "base": "C", + "x": 132.0, + "y": 97.68, + "pos": 28 + }, + { + "base": "G", + "x": 132.0, + "y": 105.24, + "pos": 29 + }, + { + "base": "G", + "x": 132.0, + "y": 112.8, + "pos": 30 + }, + { + "base": "A", + "x": 132.0, + "y": 120.36, + "pos": 31 + }, + { + "base": "C", + "x": 123.11, + "y": 127.8, + "pos": 32 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 33 + }, + { + "base": "G", + "x": 130.14, + "y": 136.62, + "pos": 34 + }, + { + "base": "U", + "x": 135.78, + "y": 137.91, + "pos": 35 + }, + { + "base": "U", + "x": 141.42, + "y": 136.62, + "pos": 36 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 37 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 38 + }, + { + "base": "U", + "x": 139.56, + "y": 120.36, + "pos": 39 + }, + { + "base": "C", + "x": 139.56, + "y": 112.8, + "pos": 40 + }, + { + "base": "C", + "x": 139.56, + "y": 105.24, + "pos": 41 + }, + { + "base": "G", + "x": 139.56, + "y": 97.68, + "pos": 42 + }, + { + "base": "U", + "x": 139.56, + "y": 90.12, + "pos": 43 + }, + { + "base": "A", + "x": 143.49, + "y": 81.05, + "pos": 44 + }, + { + "base": "U", + "x": 148.55, + "y": 73.51, + "pos": 45 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 46 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 47 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 48 + }, + { + "base": "A", + "x": 139.06, + "y": 42.56, + "pos": 49 + }, + { + "base": "C", + "x": 131.5, + "y": 42.56, + "pos": 50 + }, + { + "base": "U", + "x": 123.94, + "y": 42.56, + "pos": 51 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 53 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 54 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 55 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 56 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 57 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 58 + }, + { + "base": "G", + "x": 96.16, + "y": 28.62, + "pos": 59 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 60 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 61 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 62 + }, + { + "base": "A", + "x": 123.94, + "y": 35.0, + "pos": 63 + }, + { + "base": "G", + "x": 131.5, + "y": 35.0, + "pos": 64 + }, + { + "base": "U", + "x": 139.06, + "y": 35.0, + "pos": 65 + }, + { + "base": "C", + "x": 149.64, + "y": 35.0, + "pos": 66 + }, + { + "base": "A", + "x": 157.2, + "y": 35.0, + "pos": 67 + }, + { + "base": "G", + "x": 164.76, + "y": 35.0, + "pos": 68 + }, + { + "base": "A", + "x": 172.32, + "y": 35.0, + "pos": 69 + }, + { + "base": "G", + "x": 179.88, + "y": 35.0, + "pos": 70 + }, + { + "base": "G", + "x": 187.44, + "y": 35.0, + "pos": 71 + }, + { + "base": "A", + "x": 195.0, + "y": 35.0, + "pos": 72 + }, + { + "base": "G", + "x": 195.0, + "y": 27.44, + "pos": 73 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 75 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 76 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Asn-GTT", + "sequence": "UCCUCUGUAGUUCAGUCGGUAGAACGGCGGACUGUUAAUCCGUAUGUCACUGGUUCGAGUCCAGUCAGAGGAGCCA", + "structure": "<<<<<<<..<<<<........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.svg new file mode 100644 index 0000000..29a5c80 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.svg @@ -0,0 +1,261 @@ + + + tRNA-Asn-GTT + + + + + + + + + + + + + + + + + + + + + + + + U + + + C + + + C + + + U + + + C + + + U + + + G + + + U + + + A + + + G + + + U + + + U + + + C + + + A + + + G + + + U + + + C + + + G + + + G + + + U + + + A + + + G + + + A + + + A + + + C + + + G + + + G + + + C + + + G + + + G + + + A + + + C + + + U + + + G + + + U + + + U + + + A + + + A + + + U + + + C + + + C + + + G + + + U + + + A + + + U + + + G + + + U + + + C + + + A + + + C + + + U + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + G + + + U + + + C + + + C + + + A + + + G + + + U + + + C + + + A + + + G + + + A + + + G + + + G + + + A + + + G + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.json new file mode 100644 index 0000000..4382eb1 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.json @@ -0,0 +1,599 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "G", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "A", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "G", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "C", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "G", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "G", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "U", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "U", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "C", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 18 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 19 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 20 + }, + { + "base": "U", + "x": 102.19, + "y": 53.65, + "pos": 21 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 22 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 23 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 24 + }, + { + "base": "A", + "x": 126.96, + "y": 68.12, + "pos": 25 + }, + { + "base": "U", + "x": 134.52, + "y": 68.12, + "pos": 26 + }, + { + "base": "A", + "x": 133.13, + "y": 80.22, + "pos": 27 + }, + { + "base": "C", + "x": 132.0, + "y": 90.12, + "pos": 28 + }, + { + "base": "C", + "x": 132.0, + "y": 97.68, + "pos": 29 + }, + { + "base": "U", + "x": 132.0, + "y": 105.24, + "pos": 30 + }, + { + "base": "G", + "x": 132.0, + "y": 112.8, + "pos": 31 + }, + { + "base": "C", + "x": 132.0, + "y": 120.36, + "pos": 32 + }, + { + "base": "C", + "x": 123.11, + "y": 127.8, + "pos": 33 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 34 + }, + { + "base": "G", + "x": 130.14, + "y": 136.62, + "pos": 35 + }, + { + "base": "U", + "x": 135.78, + "y": 137.91, + "pos": 36 + }, + { + "base": "C", + "x": 141.42, + "y": 136.62, + "pos": 37 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 38 + }, + { + "base": "C", + "x": 148.45, + "y": 127.8, + "pos": 39 + }, + { + "base": "G", + "x": 139.56, + "y": 120.36, + "pos": 40 + }, + { + "base": "C", + "x": 139.56, + "y": 112.8, + "pos": 41 + }, + { + "base": "A", + "x": 139.56, + "y": 105.24, + "pos": 42 + }, + { + "base": "G", + "x": 139.56, + "y": 97.68, + "pos": 43 + }, + { + "base": "G", + "x": 139.56, + "y": 90.12, + "pos": 44 + }, + { + "base": "G", + "x": 143.49, + "y": 81.05, + "pos": 45 + }, + { + "base": "G", + "x": 148.55, + "y": 73.51, + "pos": 46 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 47 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 48 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 49 + }, + { + "base": "G", + "x": 139.06, + "y": 42.56, + "pos": 50 + }, + { + "base": "C", + "x": 131.5, + "y": 42.56, + "pos": 51 + }, + { + "base": "G", + "x": 123.94, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 53 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 54 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 55 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 56 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 57 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 58 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 59 + }, + { + "base": "G", + "x": 96.16, + "y": 28.62, + "pos": 60 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 61 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 62 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 63 + }, + { + "base": "C", + "x": 123.94, + "y": 35.0, + "pos": 64 + }, + { + "base": "G", + "x": 131.5, + "y": 35.0, + "pos": 65 + }, + { + "base": "U", + "x": 139.06, + "y": 35.0, + "pos": 66 + }, + { + "base": "C", + "x": 149.64, + "y": 35.0, + "pos": 67 + }, + { + "base": "C", + "x": 157.2, + "y": 35.0, + "pos": 68 + }, + { + "base": "G", + "x": 164.76, + "y": 35.0, + "pos": 69 + }, + { + "base": "U", + "x": 172.32, + "y": 35.0, + "pos": 70 + }, + { + "base": "U", + "x": 179.88, + "y": 35.0, + "pos": 71 + }, + { + "base": "C", + "x": 187.44, + "y": 35.0, + "pos": 72 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 73 + }, + { + "base": "G", + "x": 195.0, + "y": 27.44, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 75 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 76 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 77 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Asp-GTC", + "sequence": "GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCCUGUCACGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGCCA", + "structure": "<<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.svg new file mode 100644 index 0000000..08abe01 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.svg @@ -0,0 +1,264 @@ + + + tRNA-Asp-GTC + + + + + + + + + + + + + + + + + + + + + + + + G + + + G + + + A + + + G + + + C + + + G + + + G + + + U + + + A + + + G + + + U + + + U + + + C + + + A + + + G + + + U + + + C + + + G + + + G + + + U + + + U + + + A + + + G + + + A + + + A + + + U + + + A + + + C + + + C + + + U + + + G + + + C + + + C + + + U + + + G + + + U + + + C + + + A + + + C + + + G + + + C + + + A + + + G + + + G + + + G + + + G + + + G + + + U + + + C + + + G + + + C + + + G + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + G + + + U + + + C + + + C + + + C + + + G + + + U + + + C + + + C + + + G + + + U + + + U + + + C + + + C + + + G + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.json new file mode 100644 index 0000000..6c3c65c --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.json @@ -0,0 +1,581 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "G", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "C", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "G", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "C", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "G", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "U", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "A", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "A", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "A", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "C", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 17 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 18 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 19 + }, + { + "base": "U", + "x": 105.3, + "y": 52.57, + "pos": 20 + }, + { + "base": "A", + "x": 111.84, + "y": 68.12, + "pos": 21 + }, + { + "base": "U", + "x": 119.4, + "y": 68.12, + "pos": 22 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 23 + }, + { + "base": "U", + "x": 134.52, + "y": 68.12, + "pos": 24 + }, + { + "base": "A", + "x": 133.13, + "y": 80.22, + "pos": 25 + }, + { + "base": "G", + "x": 132.0, + "y": 90.12, + "pos": 26 + }, + { + "base": "C", + "x": 132.0, + "y": 97.68, + "pos": 27 + }, + { + "base": "G", + "x": 132.0, + "y": 105.24, + "pos": 28 + }, + { + "base": "G", + "x": 132.0, + "y": 112.8, + "pos": 29 + }, + { + "base": "A", + "x": 132.0, + "y": 120.36, + "pos": 30 + }, + { + "base": "U", + "x": 123.11, + "y": 127.8, + "pos": 31 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 32 + }, + { + "base": "G", + "x": 130.14, + "y": 136.62, + "pos": 33 + }, + { + "base": "C", + "x": 135.78, + "y": 137.91, + "pos": 34 + }, + { + "base": "A", + "x": 141.42, + "y": 136.62, + "pos": 35 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 36 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 37 + }, + { + "base": "U", + "x": 139.56, + "y": 120.36, + "pos": 38 + }, + { + "base": "C", + "x": 139.56, + "y": 112.8, + "pos": 39 + }, + { + "base": "C", + "x": 139.56, + "y": 105.24, + "pos": 40 + }, + { + "base": "G", + "x": 139.56, + "y": 97.68, + "pos": 41 + }, + { + "base": "U", + "x": 139.56, + "y": 90.12, + "pos": 42 + }, + { + "base": "C", + "x": 143.49, + "y": 81.05, + "pos": 43 + }, + { + "base": "U", + "x": 149.87, + "y": 65.96, + "pos": 44 + }, + { + "base": "A", + "x": 147.44, + "y": 58.42, + "pos": 45 + }, + { + "base": "G", + "x": 141.27, + "y": 50.87, + "pos": 46 + }, + { + "base": "U", + "x": 139.06, + "y": 42.56, + "pos": 47 + }, + { + "base": "C", + "x": 131.5, + "y": 42.56, + "pos": 48 + }, + { + "base": "C", + "x": 123.94, + "y": 42.56, + "pos": 49 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 50 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 51 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 52 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 53 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 54 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 55 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 56 + }, + { + "base": "C", + "x": 96.16, + "y": 28.62, + "pos": 57 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 58 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 59 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 60 + }, + { + "base": "G", + "x": 123.94, + "y": 35.0, + "pos": 61 + }, + { + "base": "G", + "x": 131.5, + "y": 35.0, + "pos": 62 + }, + { + "base": "A", + "x": 139.06, + "y": 35.0, + "pos": 63 + }, + { + "base": "A", + "x": 149.64, + "y": 35.0, + "pos": 64 + }, + { + "base": "C", + "x": 157.2, + "y": 35.0, + "pos": 65 + }, + { + "base": "G", + "x": 164.76, + "y": 35.0, + "pos": 66 + }, + { + "base": "C", + "x": 172.32, + "y": 35.0, + "pos": 67 + }, + { + "base": "G", + "x": 179.88, + "y": 35.0, + "pos": 68 + }, + { + "base": "C", + "x": 187.44, + "y": 35.0, + "pos": 69 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 70 + }, + { + "base": "U", + "x": 195.0, + "y": 27.44, + "pos": 71 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 72 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 73 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 74 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Cys-GCA", + "sequence": "GGCGCGUUAACAAAGCGGUUAUGUAGCGGAUUGCAAAUCCGUCUAGUCCGGUUCGACUCCGGAACGCGCCUCCA", + "structure": "<<<<<<<..<<<<.......>>>>.<<<<<.......>>>>>....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.svg new file mode 100644 index 0000000..4345635 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.svg @@ -0,0 +1,255 @@ + + + tRNA-Cys-GCA + + + + + + + + + + + + + + + + + + + + + + + + G + + + G + + + C + + + G + + + C + + + G + + + U + + + U + + + A + + + A + + + C + + + A + + + A + + + A + + + G + + + C + + + G + + + G + + + U + + + U + + + A + + + U + + + G + + + U + + + A + + + G + + + C + + + G + + + G + + + A + + + U + + + U + + + G + + + C + + + A + + + A + + + A + + + U + + + C + + + C + + + G + + + U + + + C + + + U + + + A + + + G + + + U + + + C + + + C + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + C + + + U + + + C + + + C + + + G + + + G + + + A + + + A + + + C + + + G + + + C + + + G + + + C + + + C + + + U + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.json new file mode 100644 index 0000000..36f9aca --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.json @@ -0,0 +1,587 @@ +{ + "nucleotides": [ + { + "base": "U", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "G", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "G", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "G", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "G", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "U", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "A", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "C", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "C", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "A", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "C", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 17 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 18 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 19 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 20 + }, + { + "base": "A", + "x": 111.84, + "y": 68.12, + "pos": 21 + }, + { + "base": "G", + "x": 119.4, + "y": 68.12, + "pos": 22 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 23 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 24 + }, + { + "base": "A", + "x": 133.13, + "y": 80.22, + "pos": 25 + }, + { + "base": "C", + "x": 132.0, + "y": 90.12, + "pos": 26 + }, + { + "base": "C", + "x": 132.0, + "y": 97.68, + "pos": 27 + }, + { + "base": "G", + "x": 132.0, + "y": 105.24, + "pos": 28 + }, + { + "base": "G", + "x": 132.0, + "y": 112.8, + "pos": 29 + }, + { + "base": "A", + "x": 132.0, + "y": 120.36, + "pos": 30 + }, + { + "base": "U", + "x": 123.11, + "y": 127.8, + "pos": 31 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 32 + }, + { + "base": "C", + "x": 130.14, + "y": 136.62, + "pos": 33 + }, + { + "base": "U", + "x": 135.78, + "y": 137.91, + "pos": 34 + }, + { + "base": "G", + "x": 141.42, + "y": 136.62, + "pos": 35 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 36 + }, + { + "base": "U", + "x": 148.45, + "y": 127.8, + "pos": 37 + }, + { + "base": "U", + "x": 139.56, + "y": 120.36, + "pos": 38 + }, + { + "base": "C", + "x": 139.56, + "y": 112.8, + "pos": 39 + }, + { + "base": "C", + "x": 139.56, + "y": 105.24, + "pos": 40 + }, + { + "base": "G", + "x": 139.56, + "y": 97.68, + "pos": 41 + }, + { + "base": "G", + "x": 139.56, + "y": 90.12, + "pos": 42 + }, + { + "base": "C", + "x": 143.49, + "y": 81.05, + "pos": 43 + }, + { + "base": "A", + "x": 148.55, + "y": 73.51, + "pos": 44 + }, + { + "base": "U", + "x": 149.87, + "y": 65.96, + "pos": 45 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 46 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 47 + }, + { + "base": "C", + "x": 139.06, + "y": 42.56, + "pos": 48 + }, + { + "base": "G", + "x": 131.5, + "y": 42.56, + "pos": 49 + }, + { + "base": "A", + "x": 123.94, + "y": 42.56, + "pos": 50 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 51 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 52 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 53 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 54 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 55 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 56 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 57 + }, + { + "base": "A", + "x": 96.16, + "y": 28.62, + "pos": 58 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 59 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 60 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 61 + }, + { + "base": "U", + "x": 123.94, + "y": 35.0, + "pos": 62 + }, + { + "base": "C", + "x": 131.5, + "y": 35.0, + "pos": 63 + }, + { + "base": "G", + "x": 139.06, + "y": 35.0, + "pos": 64 + }, + { + "base": "U", + "x": 149.64, + "y": 35.0, + "pos": 65 + }, + { + "base": "A", + "x": 157.2, + "y": 35.0, + "pos": 66 + }, + { + "base": "C", + "x": 164.76, + "y": 35.0, + "pos": 67 + }, + { + "base": "C", + "x": 172.32, + "y": 35.0, + "pos": 68 + }, + { + "base": "C", + "x": 179.88, + "y": 35.0, + "pos": 69 + }, + { + "base": "C", + "x": 187.44, + "y": 35.0, + "pos": 70 + }, + { + "base": "A", + "x": 195.0, + "y": 35.0, + "pos": 71 + }, + { + "base": "G", + "x": 195.0, + "y": 27.44, + "pos": 72 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 73 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 74 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 75 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Gln-CTG", + "sequence": "UGGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA", + "structure": "<<<<<<<..<<<<.......>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.svg new file mode 100644 index 0000000..3ff5f87 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.svg @@ -0,0 +1,258 @@ + + + tRNA-Gln-CTG + + + + + + + + + + + + + + + + + + + + + + + + U + + + G + + + G + + + G + + + G + + + U + + + A + + + U + + + C + + + G + + + C + + + C + + + A + + + A + + + G + + + C + + + G + + + G + + + U + + + A + + + A + + + G + + + G + + + C + + + A + + + C + + + C + + + G + + + G + + + A + + + U + + + U + + + C + + + U + + + G + + + A + + + U + + + U + + + C + + + C + + + G + + + G + + + C + + + A + + + U + + + U + + + C + + + C + + + G + + + A + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + A + + + U + + + C + + + C + + + U + + + C + + + G + + + U + + + A + + + C + + + C + + + C + + + C + + + A + + + G + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.json new file mode 100644 index 0000000..2256c2c --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.json @@ -0,0 +1,587 @@ +{ + "nucleotides": [ + { + "base": "U", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "G", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "G", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "G", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "G", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "U", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "A", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "C", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "C", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "A", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "C", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 17 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 18 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 19 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 20 + }, + { + "base": "A", + "x": 111.84, + "y": 68.12, + "pos": 21 + }, + { + "base": "G", + "x": 119.4, + "y": 68.12, + "pos": 22 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 23 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 24 + }, + { + "base": "A", + "x": 133.13, + "y": 80.22, + "pos": 25 + }, + { + "base": "C", + "x": 132.0, + "y": 90.12, + "pos": 26 + }, + { + "base": "C", + "x": 132.0, + "y": 97.68, + "pos": 27 + }, + { + "base": "G", + "x": 132.0, + "y": 105.24, + "pos": 28 + }, + { + "base": "G", + "x": 132.0, + "y": 112.8, + "pos": 29 + }, + { + "base": "U", + "x": 132.0, + "y": 120.36, + "pos": 30 + }, + { + "base": "U", + "x": 123.11, + "y": 127.8, + "pos": 31 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 32 + }, + { + "base": "U", + "x": 130.14, + "y": 136.62, + "pos": 33 + }, + { + "base": "U", + "x": 135.78, + "y": 137.91, + "pos": 34 + }, + { + "base": "G", + "x": 141.42, + "y": 136.62, + "pos": 35 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 36 + }, + { + "base": "U", + "x": 148.45, + "y": 127.8, + "pos": 37 + }, + { + "base": "A", + "x": 139.56, + "y": 120.36, + "pos": 38 + }, + { + "base": "C", + "x": 139.56, + "y": 112.8, + "pos": 39 + }, + { + "base": "C", + "x": 139.56, + "y": 105.24, + "pos": 40 + }, + { + "base": "G", + "x": 139.56, + "y": 97.68, + "pos": 41 + }, + { + "base": "G", + "x": 139.56, + "y": 90.12, + "pos": 42 + }, + { + "base": "C", + "x": 143.49, + "y": 81.05, + "pos": 43 + }, + { + "base": "A", + "x": 148.55, + "y": 73.51, + "pos": 44 + }, + { + "base": "U", + "x": 149.87, + "y": 65.96, + "pos": 45 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 46 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 47 + }, + { + "base": "C", + "x": 139.06, + "y": 42.56, + "pos": 48 + }, + { + "base": "C", + "x": 131.5, + "y": 42.56, + "pos": 49 + }, + { + "base": "U", + "x": 123.94, + "y": 42.56, + "pos": 50 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 51 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 52 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 53 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 54 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 55 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 56 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 57 + }, + { + "base": "A", + "x": 96.16, + "y": 28.62, + "pos": 58 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 59 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 60 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 61 + }, + { + "base": "A", + "x": 123.94, + "y": 35.0, + "pos": 62 + }, + { + "base": "G", + "x": 131.5, + "y": 35.0, + "pos": 63 + }, + { + "base": "G", + "x": 139.06, + "y": 35.0, + "pos": 64 + }, + { + "base": "U", + "x": 149.64, + "y": 35.0, + "pos": 65 + }, + { + "base": "A", + "x": 157.2, + "y": 35.0, + "pos": 66 + }, + { + "base": "C", + "x": 164.76, + "y": 35.0, + "pos": 67 + }, + { + "base": "C", + "x": 172.32, + "y": 35.0, + "pos": 68 + }, + { + "base": "C", + "x": 179.88, + "y": 35.0, + "pos": 69 + }, + { + "base": "C", + "x": 187.44, + "y": 35.0, + "pos": 70 + }, + { + "base": "A", + "x": 195.0, + "y": 35.0, + "pos": 71 + }, + { + "base": "G", + "x": 195.0, + "y": 27.44, + "pos": 72 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 73 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 74 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 75 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Gln-TTG", + "sequence": "UGGGGUAUCGCCAAGCGGUAAGGCACCGGUUUUUGAUACCGGCAUUCCCUGGUUCGAAUCCAGGUACCCCAGCCA", + "structure": "<<<<<<<..<<<<.......>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.svg new file mode 100644 index 0000000..388d463 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.svg @@ -0,0 +1,258 @@ + + + tRNA-Gln-TTG + + + + + + + + + + + + + + + + + + + + + + + + U + + + G + + + G + + + G + + + G + + + U + + + A + + + U + + + C + + + G + + + C + + + C + + + A + + + A + + + G + + + C + + + G + + + G + + + U + + + A + + + A + + + G + + + G + + + C + + + A + + + C + + + C + + + G + + + G + + + U + + + U + + + U + + + U + + + U + + + G + + + A + + + U + + + A + + + C + + + C + + + G + + + G + + + C + + + A + + + U + + + U + + + C + + + C + + + C + + + U + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + A + + + U + + + C + + + C + + + A + + + G + + + G + + + U + + + A + + + C + + + C + + + C + + + C + + + A + + + G + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.json new file mode 100644 index 0000000..cc0ef9e --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.json @@ -0,0 +1,593 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "U", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "C", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "C", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "C", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "C", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "U", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "C", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "U", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "C", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "U", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "A", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 17 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 18 + }, + { + "base": "C", + "x": 100.97, + "y": 54.36, + "pos": 19 + }, + { + "base": "C", + "x": 102.19, + "y": 53.65, + "pos": 20 + }, + { + "base": "C", + "x": 103.49, + "y": 53.08, + "pos": 21 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 22 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 23 + }, + { + "base": "G", + "x": 119.4, + "y": 68.12, + "pos": 24 + }, + { + "base": "A", + "x": 126.96, + "y": 68.12, + "pos": 25 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 26 + }, + { + "base": "A", + "x": 133.13, + "y": 80.22, + "pos": 27 + }, + { + "base": "C", + "x": 132.0, + "y": 90.12, + "pos": 28 + }, + { + "base": "C", + "x": 132.0, + "y": 97.68, + "pos": 29 + }, + { + "base": "G", + "x": 132.0, + "y": 105.24, + "pos": 30 + }, + { + "base": "C", + "x": 132.0, + "y": 112.8, + "pos": 31 + }, + { + "base": "C", + "x": 132.0, + "y": 120.36, + "pos": 32 + }, + { + "base": "C", + "x": 123.11, + "y": 127.8, + "pos": 33 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 34 + }, + { + "base": "U", + "x": 130.14, + "y": 136.62, + "pos": 35 + }, + { + "base": "U", + "x": 135.78, + "y": 137.91, + "pos": 36 + }, + { + "base": "C", + "x": 141.42, + "y": 136.62, + "pos": 37 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 38 + }, + { + "base": "C", + "x": 148.45, + "y": 127.8, + "pos": 39 + }, + { + "base": "G", + "x": 139.56, + "y": 120.36, + "pos": 40 + }, + { + "base": "G", + "x": 139.56, + "y": 112.8, + "pos": 41 + }, + { + "base": "C", + "x": 139.56, + "y": 105.24, + "pos": 42 + }, + { + "base": "G", + "x": 139.56, + "y": 97.68, + "pos": 43 + }, + { + "base": "G", + "x": 139.56, + "y": 90.12, + "pos": 44 + }, + { + "base": "U", + "x": 143.49, + "y": 81.05, + "pos": 45 + }, + { + "base": "A", + "x": 149.87, + "y": 65.96, + "pos": 46 + }, + { + "base": "A", + "x": 147.44, + "y": 58.42, + "pos": 47 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 48 + }, + { + "base": "A", + "x": 139.06, + "y": 42.56, + "pos": 49 + }, + { + "base": "G", + "x": 131.5, + "y": 42.56, + "pos": 50 + }, + { + "base": "G", + "x": 123.94, + "y": 42.56, + "pos": 51 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 53 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 54 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 55 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 56 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 57 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 58 + }, + { + "base": "A", + "x": 96.16, + "y": 28.62, + "pos": 59 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 60 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 61 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 62 + }, + { + "base": "C", + "x": 123.94, + "y": 35.0, + "pos": 63 + }, + { + "base": "C", + "x": 131.5, + "y": 35.0, + "pos": 64 + }, + { + "base": "U", + "x": 139.06, + "y": 35.0, + "pos": 65 + }, + { + "base": "A", + "x": 149.64, + "y": 35.0, + "pos": 66 + }, + { + "base": "G", + "x": 157.2, + "y": 35.0, + "pos": 67 + }, + { + "base": "G", + "x": 164.76, + "y": 35.0, + "pos": 68 + }, + { + "base": "G", + "x": 172.32, + "y": 35.0, + "pos": 69 + }, + { + "base": "G", + "x": 179.88, + "y": 35.0, + "pos": 70 + }, + { + "base": "A", + "x": 187.44, + "y": 35.0, + "pos": 71 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 72 + }, + { + "base": "G", + "x": 195.0, + "y": 27.44, + "pos": 73 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 75 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 76 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Glu-TTC", + "sequence": "GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUUUCACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGCCA", + "structure": "<<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.svg new file mode 100644 index 0000000..2d39c5f --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.svg @@ -0,0 +1,261 @@ + + + tRNA-Glu-TTC + + + + + + + + + + + + + + + + + + + + + + + + G + + + U + + + C + + + C + + + C + + + C + + + U + + + U + + + C + + + G + + + U + + + C + + + U + + + A + + + G + + + A + + + G + + + G + + + C + + + C + + + C + + + A + + + G + + + G + + + A + + + C + + + A + + + C + + + C + + + G + + + C + + + C + + + C + + + U + + + U + + + U + + + C + + + A + + + C + + + G + + + G + + + C + + + G + + + G + + + U + + + A + + + A + + + C + + + A + + + G + + + G + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + A + + + U + + + C + + + C + + + C + + + C + + + U + + + A + + + G + + + G + + + G + + + G + + + A + + + C + + + G + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.json new file mode 100644 index 0000000..23a14d0 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.json @@ -0,0 +1,581 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "C", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "G", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "G", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "G", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "C", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "G", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "U", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "A", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "U", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 17 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 18 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 19 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 20 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 21 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 22 + }, + { + "base": "A", + "x": 126.96, + "y": 68.12, + "pos": 23 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 24 + }, + { + "base": "G", + "x": 133.13, + "y": 80.22, + "pos": 25 + }, + { + "base": "A", + "x": 132.0, + "y": 90.12, + "pos": 26 + }, + { + "base": "G", + "x": 132.0, + "y": 97.68, + "pos": 27 + }, + { + "base": "A", + "x": 132.0, + "y": 105.24, + "pos": 28 + }, + { + "base": "G", + "x": 132.0, + "y": 112.8, + "pos": 29 + }, + { + "base": "C", + "x": 132.0, + "y": 120.36, + "pos": 30 + }, + { + "base": "U", + "x": 123.11, + "y": 127.8, + "pos": 31 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 32 + }, + { + "base": "C", + "x": 130.14, + "y": 136.62, + "pos": 33 + }, + { + "base": "C", + "x": 135.78, + "y": 137.91, + "pos": 34 + }, + { + "base": "C", + "x": 141.42, + "y": 136.62, + "pos": 35 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 36 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 37 + }, + { + "base": "G", + "x": 139.56, + "y": 120.36, + "pos": 38 + }, + { + "base": "C", + "x": 139.56, + "y": 112.8, + "pos": 39 + }, + { + "base": "U", + "x": 139.56, + "y": 105.24, + "pos": 40 + }, + { + "base": "C", + "x": 139.56, + "y": 97.68, + "pos": 41 + }, + { + "base": "U", + "x": 139.56, + "y": 90.12, + "pos": 42 + }, + { + "base": "A", + "x": 143.49, + "y": 81.05, + "pos": 43 + }, + { + "base": "U", + "x": 149.87, + "y": 65.96, + "pos": 44 + }, + { + "base": "A", + "x": 147.44, + "y": 58.42, + "pos": 45 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 46 + }, + { + "base": "G", + "x": 139.06, + "y": 42.56, + "pos": 47 + }, + { + "base": "A", + "x": 131.5, + "y": 42.56, + "pos": 48 + }, + { + "base": "G", + "x": 123.94, + "y": 42.56, + "pos": 49 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 50 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 51 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 52 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 53 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 54 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 55 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 56 + }, + { + "base": "U", + "x": 96.16, + "y": 28.62, + "pos": 57 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 58 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 59 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 60 + }, + { + "base": "C", + "x": 123.94, + "y": 35.0, + "pos": 61 + }, + { + "base": "U", + "x": 131.5, + "y": 35.0, + "pos": 62 + }, + { + "base": "U", + "x": 139.06, + "y": 35.0, + "pos": 63 + }, + { + "base": "C", + "x": 149.64, + "y": 35.0, + "pos": 64 + }, + { + "base": "G", + "x": 157.2, + "y": 35.0, + "pos": 65 + }, + { + "base": "C", + "x": 164.76, + "y": 35.0, + "pos": 66 + }, + { + "base": "C", + "x": 172.32, + "y": 35.0, + "pos": 67 + }, + { + "base": "C", + "x": 179.88, + "y": 35.0, + "pos": 68 + }, + { + "base": "G", + "x": 187.44, + "y": 35.0, + "pos": 69 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 70 + }, + { + "base": "U", + "x": 195.0, + "y": 27.44, + "pos": 71 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 72 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 73 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 74 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Gly-CCC", + "sequence": "GCGGGCGUAGUUCAAUGGUAGAACGAGAGCUUCCCAAGCUCUAUACGAGGGUUCGAUUCCCUUCGCCCGCUCCA", + "structure": "<<<<<<<..<<<<.......>>>>.<<<<<.......>>>>>....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.svg new file mode 100644 index 0000000..6e03b40 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.svg @@ -0,0 +1,255 @@ + + + tRNA-Gly-CCC + + + + + + + + + + + + + + + + + + + + + + + + G + + + C + + + G + + + G + + + G + + + C + + + G + + + U + + + A + + + G + + + U + + + U + + + C + + + A + + + A + + + U + + + G + + + G + + + U + + + A + + + G + + + A + + + A + + + C + + + G + + + A + + + G + + + A + + + G + + + C + + + U + + + U + + + C + + + C + + + C + + + A + + + A + + + G + + + C + + + U + + + C + + + U + + + A + + + U + + + A + + + C + + + G + + + A + + + G + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + U + + + U + + + C + + + C + + + C + + + U + + + U + + + C + + + G + + + C + + + C + + + C + + + G + + + C + + + U + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.json new file mode 100644 index 0000000..34c8cb5 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.json @@ -0,0 +1,593 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "C", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "G", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "G", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "G", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "A", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "A", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "U", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "U", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 18 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 19 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 20 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 21 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 22 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 23 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 24 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 25 + }, + { + "base": "A", + "x": 133.13, + "y": 80.22, + "pos": 26 + }, + { + "base": "C", + "x": 132.0, + "y": 90.12, + "pos": 27 + }, + { + "base": "G", + "x": 132.0, + "y": 97.68, + "pos": 28 + }, + { + "base": "A", + "x": 132.0, + "y": 105.24, + "pos": 29 + }, + { + "base": "C", + "x": 132.0, + "y": 112.8, + "pos": 30 + }, + { + "base": "C", + "x": 132.0, + "y": 120.36, + "pos": 31 + }, + { + "base": "U", + "x": 123.11, + "y": 127.8, + "pos": 32 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 33 + }, + { + "base": "G", + "x": 130.14, + "y": 136.62, + "pos": 34 + }, + { + "base": "C", + "x": 135.78, + "y": 137.91, + "pos": 35 + }, + { + "base": "C", + "x": 141.42, + "y": 136.62, + "pos": 36 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 37 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 38 + }, + { + "base": "G", + "x": 139.56, + "y": 120.36, + "pos": 39 + }, + { + "base": "G", + "x": 139.56, + "y": 112.8, + "pos": 40 + }, + { + "base": "U", + "x": 139.56, + "y": 105.24, + "pos": 41 + }, + { + "base": "C", + "x": 139.56, + "y": 97.68, + "pos": 42 + }, + { + "base": "G", + "x": 139.56, + "y": 90.12, + "pos": 43 + }, + { + "base": "G", + "x": 143.49, + "y": 81.05, + "pos": 44 + }, + { + "base": "G", + "x": 148.55, + "y": 73.51, + "pos": 45 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 46 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 47 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 48 + }, + { + "base": "G", + "x": 139.06, + "y": 42.56, + "pos": 49 + }, + { + "base": "C", + "x": 131.5, + "y": 42.56, + "pos": 50 + }, + { + "base": "G", + "x": 123.94, + "y": 42.56, + "pos": 51 + }, + { + "base": "A", + "x": 116.38, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 53 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 54 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 55 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 56 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 57 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 58 + }, + { + "base": "G", + "x": 96.16, + "y": 28.62, + "pos": 59 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 60 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 61 + }, + { + "base": "U", + "x": 116.38, + "y": 35.0, + "pos": 62 + }, + { + "base": "C", + "x": 123.94, + "y": 35.0, + "pos": 63 + }, + { + "base": "G", + "x": 131.5, + "y": 35.0, + "pos": 64 + }, + { + "base": "U", + "x": 139.06, + "y": 35.0, + "pos": 65 + }, + { + "base": "U", + "x": 149.64, + "y": 35.0, + "pos": 66 + }, + { + "base": "U", + "x": 157.2, + "y": 35.0, + "pos": 67 + }, + { + "base": "C", + "x": 164.76, + "y": 35.0, + "pos": 68 + }, + { + "base": "C", + "x": 172.32, + "y": 35.0, + "pos": 69 + }, + { + "base": "C", + "x": 179.88, + "y": 35.0, + "pos": 70 + }, + { + "base": "G", + "x": 187.44, + "y": 35.0, + "pos": 71 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 72 + }, + { + "base": "U", + "x": 195.0, + "y": 27.44, + "pos": 73 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 75 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 76 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Gly-GCC", + "sequence": "GCGGGAAUAGCUCAGUUGGUAGAGCACGACCUUGCCAAGGUCGGGGUCGCGAGUUCGAGUCUCGUUUCCCGCUCCA", + "structure": "<<<<<<<..<<<<........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.svg new file mode 100644 index 0000000..3ef2f53 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.svg @@ -0,0 +1,261 @@ + + + tRNA-Gly-GCC + + + + + + + + + + + + + + + + + + + + + + + + G + + + C + + + G + + + G + + + G + + + A + + + A + + + U + + + A + + + G + + + C + + + U + + + C + + + A + + + G + + + U + + + U + + + G + + + G + + + U + + + A + + + G + + + A + + + G + + + C + + + A + + + C + + + G + + + A + + + C + + + C + + + U + + + U + + + G + + + C + + + C + + + A + + + A + + + G + + + G + + + U + + + C + + + G + + + G + + + G + + + G + + + U + + + C + + + G + + + C + + + G + + + A + + + G + + + U + + + U + + + C + + + G + + + A + + + G + + + U + + + C + + + U + + + C + + + G + + + U + + + U + + + U + + + C + + + C + + + C + + + G + + + C + + + U + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.json new file mode 100644 index 0000000..cc633c5 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.json @@ -0,0 +1,587 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "C", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "G", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "G", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "G", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "C", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "A", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "C", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "U", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "A", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "U", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "A", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "U", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 17 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 18 + }, + { + "base": "C", + "x": 100.97, + "y": 54.36, + "pos": 19 + }, + { + "base": "U", + "x": 102.19, + "y": 53.65, + "pos": 20 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 21 + }, + { + "base": "U", + "x": 111.84, + "y": 68.12, + "pos": 22 + }, + { + "base": "U", + "x": 119.4, + "y": 68.12, + "pos": 23 + }, + { + "base": "A", + "x": 126.96, + "y": 68.12, + "pos": 24 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 25 + }, + { + "base": "C", + "x": 133.13, + "y": 80.22, + "pos": 26 + }, + { + "base": "U", + "x": 132.0, + "y": 90.12, + "pos": 27 + }, + { + "base": "C", + "x": 132.0, + "y": 97.68, + "pos": 28 + }, + { + "base": "A", + "x": 132.0, + "y": 105.24, + "pos": 29 + }, + { + "base": "G", + "x": 132.0, + "y": 112.8, + "pos": 30 + }, + { + "base": "C", + "x": 132.0, + "y": 120.36, + "pos": 31 + }, + { + "base": "C", + "x": 123.11, + "y": 127.8, + "pos": 32 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 33 + }, + { + "base": "U", + "x": 130.14, + "y": 136.62, + "pos": 34 + }, + { + "base": "C", + "x": 135.78, + "y": 137.91, + "pos": 35 + }, + { + "base": "C", + "x": 141.42, + "y": 136.62, + "pos": 36 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 37 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 38 + }, + { + "base": "G", + "x": 139.56, + "y": 120.36, + "pos": 39 + }, + { + "base": "C", + "x": 139.56, + "y": 112.8, + "pos": 40 + }, + { + "base": "U", + "x": 139.56, + "y": 105.24, + "pos": 41 + }, + { + "base": "G", + "x": 139.56, + "y": 97.68, + "pos": 42 + }, + { + "base": "A", + "x": 139.56, + "y": 90.12, + "pos": 43 + }, + { + "base": "U", + "x": 143.49, + "y": 81.05, + "pos": 44 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 45 + }, + { + "base": "A", + "x": 147.44, + "y": 58.42, + "pos": 46 + }, + { + "base": "U", + "x": 141.27, + "y": 50.87, + "pos": 47 + }, + { + "base": "G", + "x": 139.06, + "y": 42.56, + "pos": 48 + }, + { + "base": "C", + "x": 131.5, + "y": 42.56, + "pos": 49 + }, + { + "base": "G", + "x": 123.94, + "y": 42.56, + "pos": 50 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 51 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 52 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 53 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 54 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 55 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 56 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 57 + }, + { + "base": "U", + "x": 96.16, + "y": 28.62, + "pos": 58 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 59 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 60 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 61 + }, + { + "base": "C", + "x": 123.94, + "y": 35.0, + "pos": 62 + }, + { + "base": "G", + "x": 131.5, + "y": 35.0, + "pos": 63 + }, + { + "base": "C", + "x": 139.06, + "y": 35.0, + "pos": 64 + }, + { + "base": "U", + "x": 149.64, + "y": 35.0, + "pos": 65 + }, + { + "base": "G", + "x": 157.2, + "y": 35.0, + "pos": 66 + }, + { + "base": "C", + "x": 164.76, + "y": 35.0, + "pos": 67 + }, + { + "base": "C", + "x": 172.32, + "y": 35.0, + "pos": 68 + }, + { + "base": "C", + "x": 179.88, + "y": 35.0, + "pos": 69 + }, + { + "base": "G", + "x": 187.44, + "y": 35.0, + "pos": 70 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 71 + }, + { + "base": "U", + "x": 195.0, + "y": 27.44, + "pos": 72 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 73 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 74 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 75 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Gly-TCC", + "sequence": "GCGGGCAUCGUAUAAUGGCUAUUACCUCAGCCUUCCAAGCUGAUGAUGCGGGUUCGAUUCCCGCUGCCCGCUCCA", + "structure": "<<<<<<<..<<<<........>>>>.<<<<<.......>>>>>....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.svg new file mode 100644 index 0000000..ba1daee --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.svg @@ -0,0 +1,258 @@ + + + tRNA-Gly-TCC + + + + + + + + + + + + + + + + + + + + + + + + G + + + C + + + G + + + G + + + G + + + C + + + A + + + U + + + C + + + G + + + U + + + A + + + U + + + A + + + A + + + U + + + G + + + G + + + C + + + U + + + A + + + U + + + U + + + A + + + C + + + C + + + U + + + C + + + A + + + G + + + C + + + C + + + U + + + U + + + C + + + C + + + A + + + A + + + G + + + C + + + U + + + G + + + A + + + U + + + G + + + A + + + U + + + G + + + C + + + G + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + U + + + U + + + C + + + C + + + C + + + G + + + C + + + U + + + G + + + C + + + C + + + C + + + G + + + C + + + U + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.json new file mode 100644 index 0000000..3ccb1f0 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.json @@ -0,0 +1,593 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "U", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "G", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "G", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "C", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "U", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "A", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "U", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "U", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 18 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 19 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 20 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 21 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 22 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 23 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 24 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 25 + }, + { + "base": "C", + "x": 133.13, + "y": 80.22, + "pos": 26 + }, + { + "base": "C", + "x": 132.0, + "y": 90.12, + "pos": 27 + }, + { + "base": "U", + "x": 132.0, + "y": 97.68, + "pos": 28 + }, + { + "base": "G", + "x": 132.0, + "y": 105.24, + "pos": 29 + }, + { + "base": "G", + "x": 132.0, + "y": 112.8, + "pos": 30 + }, + { + "base": "A", + "x": 132.0, + "y": 120.36, + "pos": 31 + }, + { + "base": "U", + "x": 123.11, + "y": 127.8, + "pos": 32 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 33 + }, + { + "base": "G", + "x": 130.14, + "y": 136.62, + "pos": 34 + }, + { + "base": "U", + "x": 135.78, + "y": 137.91, + "pos": 35 + }, + { + "base": "G", + "x": 141.42, + "y": 136.62, + "pos": 36 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 37 + }, + { + "base": "U", + "x": 148.45, + "y": 127.8, + "pos": 38 + }, + { + "base": "U", + "x": 139.56, + "y": 120.36, + "pos": 39 + }, + { + "base": "C", + "x": 139.56, + "y": 112.8, + "pos": 40 + }, + { + "base": "C", + "x": 139.56, + "y": 105.24, + "pos": 41 + }, + { + "base": "A", + "x": 139.56, + "y": 97.68, + "pos": 42 + }, + { + "base": "G", + "x": 139.56, + "y": 90.12, + "pos": 43 + }, + { + "base": "U", + "x": 143.49, + "y": 81.05, + "pos": 44 + }, + { + "base": "U", + "x": 148.55, + "y": 73.51, + "pos": 45 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 46 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 47 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 48 + }, + { + "base": "G", + "x": 139.06, + "y": 42.56, + "pos": 49 + }, + { + "base": "U", + "x": 131.5, + "y": 42.56, + "pos": 50 + }, + { + "base": "G", + "x": 123.94, + "y": 42.56, + "pos": 51 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 53 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 54 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 55 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 56 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 57 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 58 + }, + { + "base": "A", + "x": 96.16, + "y": 28.62, + "pos": 59 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 60 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 61 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 62 + }, + { + "base": "C", + "x": 123.94, + "y": 35.0, + "pos": 63 + }, + { + "base": "A", + "x": 131.5, + "y": 35.0, + "pos": 64 + }, + { + "base": "U", + "x": 139.06, + "y": 35.0, + "pos": 65 + }, + { + "base": "U", + "x": 149.64, + "y": 35.0, + "pos": 66 + }, + { + "base": "A", + "x": 157.2, + "y": 35.0, + "pos": 67 + }, + { + "base": "G", + "x": 164.76, + "y": 35.0, + "pos": 68 + }, + { + "base": "C", + "x": 172.32, + "y": 35.0, + "pos": 69 + }, + { + "base": "C", + "x": 179.88, + "y": 35.0, + "pos": 70 + }, + { + "base": "A", + "x": 187.44, + "y": 35.0, + "pos": 71 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 72 + }, + { + "base": "C", + "x": 195.0, + "y": 27.44, + "pos": 73 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 75 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 76 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-His-GTG", + "sequence": "GUGGCUAUAGCUCAGUUGGUAGAGCCCUGGAUUGUGAUUCCAGUUGUCGUGGGUUCGAAUCCCAUUAGCCACCCCA", + "structure": "<<<<<<<..<<<<........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.svg new file mode 100644 index 0000000..02036ff --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.svg @@ -0,0 +1,261 @@ + + + tRNA-His-GTG + + + + + + + + + + + + + + + + + + + + + + + + G + + + U + + + G + + + G + + + C + + + U + + + A + + + U + + + A + + + G + + + C + + + U + + + C + + + A + + + G + + + U + + + U + + + G + + + G + + + U + + + A + + + G + + + A + + + G + + + C + + + C + + + C + + + U + + + G + + + G + + + A + + + U + + + U + + + G + + + U + + + G + + + A + + + U + + + U + + + C + + + C + + + A + + + G + + + U + + + U + + + G + + + U + + + C + + + G + + + U + + + G + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + A + + + U + + + C + + + C + + + C + + + A + + + U + + + U + + + A + + + G + + + C + + + C + + + A + + + C + + + C + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.json new file mode 100644 index 0000000..3ceaef2 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.json @@ -0,0 +1,599 @@ +{ + "nucleotides": [ + { + "base": "A", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "G", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "G", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "C", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "U", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "U", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "G", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "G", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "U", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 18 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 19 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 20 + }, + { + "base": "U", + "x": 102.19, + "y": 53.65, + "pos": 21 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 22 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 23 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 24 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 25 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 26 + }, + { + "base": "G", + "x": 133.13, + "y": 80.22, + "pos": 27 + }, + { + "base": "C", + "x": 132.0, + "y": 90.12, + "pos": 28 + }, + { + "base": "A", + "x": 132.0, + "y": 97.68, + "pos": 29 + }, + { + "base": "C", + "x": 132.0, + "y": 105.24, + "pos": 30 + }, + { + "base": "C", + "x": 132.0, + "y": 112.8, + "pos": 31 + }, + { + "base": "C", + "x": 132.0, + "y": 120.36, + "pos": 32 + }, + { + "base": "C", + "x": 123.11, + "y": 127.8, + "pos": 33 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 34 + }, + { + "base": "G", + "x": 130.14, + "y": 136.62, + "pos": 35 + }, + { + "base": "A", + "x": 135.78, + "y": 137.91, + "pos": 36 + }, + { + "base": "U", + "x": 141.42, + "y": 136.62, + "pos": 37 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 38 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 39 + }, + { + "base": "G", + "x": 139.56, + "y": 120.36, + "pos": 40 + }, + { + "base": "G", + "x": 139.56, + "y": 112.8, + "pos": 41 + }, + { + "base": "G", + "x": 139.56, + "y": 105.24, + "pos": 42 + }, + { + "base": "U", + "x": 139.56, + "y": 97.68, + "pos": 43 + }, + { + "base": "G", + "x": 139.56, + "y": 90.12, + "pos": 44 + }, + { + "base": "A", + "x": 143.49, + "y": 81.05, + "pos": 45 + }, + { + "base": "G", + "x": 148.55, + "y": 73.51, + "pos": 46 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 47 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 48 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 49 + }, + { + "base": "G", + "x": 139.06, + "y": 42.56, + "pos": 50 + }, + { + "base": "G", + "x": 131.5, + "y": 42.56, + "pos": 51 + }, + { + "base": "U", + "x": 123.94, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 53 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 54 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 55 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 56 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 57 + }, + { + "base": "A", + "x": 91.27, + "y": 38.78, + "pos": 58 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 59 + }, + { + "base": "G", + "x": 96.16, + "y": 28.62, + "pos": 60 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 61 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 62 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 63 + }, + { + "base": "A", + "x": 123.94, + "y": 35.0, + "pos": 64 + }, + { + "base": "C", + "x": 131.5, + "y": 35.0, + "pos": 65 + }, + { + "base": "U", + "x": 139.06, + "y": 35.0, + "pos": 66 + }, + { + "base": "C", + "x": 149.64, + "y": 35.0, + "pos": 67 + }, + { + "base": "A", + "x": 157.2, + "y": 35.0, + "pos": 68 + }, + { + "base": "G", + "x": 164.76, + "y": 35.0, + "pos": 69 + }, + { + "base": "G", + "x": 172.32, + "y": 35.0, + "pos": 70 + }, + { + "base": "C", + "x": 179.88, + "y": 35.0, + "pos": 71 + }, + { + "base": "C", + "x": 187.44, + "y": 35.0, + "pos": 72 + }, + { + "base": "U", + "x": 195.0, + "y": 35.0, + "pos": 73 + }, + { + "base": "A", + "x": 195.0, + "y": 27.44, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 75 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 76 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 77 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Ile-GAT", + "sequence": "AGGCUUGUAGCUCAGGUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGGUGGUUCAAGUCCACUCAGGCCUACCA", + "structure": "<<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.svg new file mode 100644 index 0000000..1d1d2d1 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.svg @@ -0,0 +1,264 @@ + + + tRNA-Ile-GAT + + + + + + + + + + + + + + + + + + + + + + + + A + + + G + + + G + + + C + + + U + + + U + + + G + + + U + + + A + + + G + + + C + + + U + + + C + + + A + + + G + + + G + + + U + + + G + + + G + + + U + + + U + + + A + + + G + + + A + + + G + + + C + + + G + + + C + + + A + + + C + + + C + + + C + + + C + + + U + + + G + + + A + + + U + + + A + + + A + + + G + + + G + + + G + + + U + + + G + + + A + + + G + + + G + + + U + + + C + + + G + + + G + + + U + + + G + + + G + + + U + + + U + + + C + + + A + + + A + + + G + + + U + + + C + + + C + + + A + + + C + + + U + + + C + + + A + + + G + + + G + + + C + + + C + + + U + + + A + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.json new file mode 100644 index 0000000..864e10c --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.json @@ -0,0 +1,593 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "G", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "G", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "U", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "C", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "G", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "U", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "U", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "U", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 18 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 19 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 20 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 21 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 22 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 23 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 24 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 25 + }, + { + "base": "A", + "x": 133.13, + "y": 80.22, + "pos": 26 + }, + { + "base": "G", + "x": 132.0, + "y": 90.12, + "pos": 27 + }, + { + "base": "U", + "x": 132.0, + "y": 97.68, + "pos": 28 + }, + { + "base": "U", + "x": 132.0, + "y": 105.24, + "pos": 29 + }, + { + "base": "G", + "x": 132.0, + "y": 112.8, + "pos": 30 + }, + { + "base": "A", + "x": 132.0, + "y": 120.36, + "pos": 31 + }, + { + "base": "C", + "x": 123.11, + "y": 127.8, + "pos": 32 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 33 + }, + { + "base": "U", + "x": 130.14, + "y": 136.62, + "pos": 34 + }, + { + "base": "U", + "x": 135.78, + "y": 137.91, + "pos": 35 + }, + { + "base": "U", + "x": 141.42, + "y": 136.62, + "pos": 36 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 37 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 38 + }, + { + "base": "U", + "x": 139.56, + "y": 120.36, + "pos": 39 + }, + { + "base": "C", + "x": 139.56, + "y": 112.8, + "pos": 40 + }, + { + "base": "A", + "x": 139.56, + "y": 105.24, + "pos": 41 + }, + { + "base": "A", + "x": 139.56, + "y": 97.68, + "pos": 42 + }, + { + "base": "U", + "x": 139.56, + "y": 90.12, + "pos": 43 + }, + { + "base": "U", + "x": 143.49, + "y": 81.05, + "pos": 44 + }, + { + "base": "G", + "x": 148.55, + "y": 73.51, + "pos": 45 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 46 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 47 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 48 + }, + { + "base": "G", + "x": 139.06, + "y": 42.56, + "pos": 49 + }, + { + "base": "C", + "x": 131.5, + "y": 42.56, + "pos": 50 + }, + { + "base": "A", + "x": 123.94, + "y": 42.56, + "pos": 51 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 53 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 54 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 55 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 56 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 57 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 58 + }, + { + "base": "A", + "x": 96.16, + "y": 28.62, + "pos": 59 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 60 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 61 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 62 + }, + { + "base": "U", + "x": 123.94, + "y": 35.0, + "pos": 63 + }, + { + "base": "G", + "x": 131.5, + "y": 35.0, + "pos": 64 + }, + { + "base": "C", + "x": 139.06, + "y": 35.0, + "pos": 65 + }, + { + "base": "A", + "x": 149.64, + "y": 35.0, + "pos": 66 + }, + { + "base": "C", + "x": 157.2, + "y": 35.0, + "pos": 67 + }, + { + "base": "G", + "x": 164.76, + "y": 35.0, + "pos": 68 + }, + { + "base": "A", + "x": 172.32, + "y": 35.0, + "pos": 69 + }, + { + "base": "C", + "x": 179.88, + "y": 35.0, + "pos": 70 + }, + { + "base": "C", + "x": 187.44, + "y": 35.0, + "pos": 71 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 72 + }, + { + "base": "A", + "x": 195.0, + "y": 27.44, + "pos": 73 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 75 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 76 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Lys-TTT", + "sequence": "GGGUCGUUAGCUCAGUUGGUAGAGCAGUUGACUUUUAAUCAAUUGGUCGCAGGUUCGAAUCCUGCACGACCCACCA", + "structure": "<<<<<<<..<<<<........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.svg new file mode 100644 index 0000000..dae9ea3 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.svg @@ -0,0 +1,261 @@ + + + tRNA-Lys-TTT + + + + + + + + + + + + + + + + + + + + + + + + G + + + G + + + G + + + U + + + C + + + G + + + U + + + U + + + A + + + G + + + C + + + U + + + C + + + A + + + G + + + U + + + U + + + G + + + G + + + U + + + A + + + G + + + A + + + G + + + C + + + A + + + G + + + U + + + U + + + G + + + A + + + C + + + U + + + U + + + U + + + U + + + A + + + A + + + U + + + C + + + A + + + A + + + U + + + U + + + G + + + G + + + U + + + C + + + G + + + C + + + A + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + A + + + U + + + C + + + C + + + U + + + G + + + C + + + A + + + C + + + G + + + A + + + C + + + C + + + C + + + A + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.json new file mode 100644 index 0000000..650b7f4 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.json @@ -0,0 +1,599 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "G", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "C", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "U", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "A", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "C", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "G", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "U", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "U", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 18 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 19 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 20 + }, + { + "base": "U", + "x": 102.19, + "y": 53.65, + "pos": 21 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 22 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 23 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 24 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 25 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 26 + }, + { + "base": "A", + "x": 133.13, + "y": 80.22, + "pos": 27 + }, + { + "base": "C", + "x": 132.0, + "y": 90.12, + "pos": 28 + }, + { + "base": "A", + "x": 132.0, + "y": 97.68, + "pos": 29 + }, + { + "base": "U", + "x": 132.0, + "y": 105.24, + "pos": 30 + }, + { + "base": "C", + "x": 132.0, + "y": 112.8, + "pos": 31 + }, + { + "base": "A", + "x": 132.0, + "y": 120.36, + "pos": 32 + }, + { + "base": "C", + "x": 123.11, + "y": 127.8, + "pos": 33 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 34 + }, + { + "base": "C", + "x": 130.14, + "y": 136.62, + "pos": 35 + }, + { + "base": "A", + "x": 135.78, + "y": 137.91, + "pos": 36 + }, + { + "base": "U", + "x": 141.42, + "y": 136.62, + "pos": 37 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 38 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 39 + }, + { + "base": "U", + "x": 139.56, + "y": 120.36, + "pos": 40 + }, + { + "base": "G", + "x": 139.56, + "y": 112.8, + "pos": 41 + }, + { + "base": "A", + "x": 139.56, + "y": 105.24, + "pos": 42 + }, + { + "base": "U", + "x": 139.56, + "y": 97.68, + "pos": 43 + }, + { + "base": "G", + "x": 139.56, + "y": 90.12, + "pos": 44 + }, + { + "base": "G", + "x": 143.49, + "y": 81.05, + "pos": 45 + }, + { + "base": "G", + "x": 148.55, + "y": 73.51, + "pos": 46 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 47 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 48 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 49 + }, + { + "base": "A", + "x": 139.06, + "y": 42.56, + "pos": 50 + }, + { + "base": "C", + "x": 131.5, + "y": 42.56, + "pos": 51 + }, + { + "base": "A", + "x": 123.94, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 53 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 54 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 55 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 56 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 57 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 58 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 59 + }, + { + "base": "A", + "x": 96.16, + "y": 28.62, + "pos": 60 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 61 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 62 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 63 + }, + { + "base": "C", + "x": 123.94, + "y": 35.0, + "pos": 64 + }, + { + "base": "G", + "x": 131.5, + "y": 35.0, + "pos": 65 + }, + { + "base": "U", + "x": 139.06, + "y": 35.0, + "pos": 66 + }, + { + "base": "C", + "x": 149.64, + "y": 35.0, + "pos": 67 + }, + { + "base": "G", + "x": 157.2, + "y": 35.0, + "pos": 68 + }, + { + "base": "U", + "x": 164.76, + "y": 35.0, + "pos": 69 + }, + { + "base": "A", + "x": 172.32, + "y": 35.0, + "pos": 70 + }, + { + "base": "G", + "x": 179.88, + "y": 35.0, + "pos": 71 + }, + { + "base": "C", + "x": 187.44, + "y": 35.0, + "pos": 72 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 73 + }, + { + "base": "A", + "x": 195.0, + "y": 27.44, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 75 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 76 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 77 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Met-CAT", + "sequence": "GGCUACGUAGCUCAGUUGGUUAGAGCACAUCACUCAUAAUGAUGGGGUCACAGGUUCGAAUCCCGUCGUAGCCACCA", + "structure": "<<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.svg new file mode 100644 index 0000000..e47e6d7 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.svg @@ -0,0 +1,264 @@ + + + tRNA-Met-CAT + + + + + + + + + + + + + + + + + + + + + + + + G + + + G + + + C + + + U + + + A + + + C + + + G + + + U + + + A + + + G + + + C + + + U + + + C + + + A + + + G + + + U + + + U + + + G + + + G + + + U + + + U + + + A + + + G + + + A + + + G + + + C + + + A + + + C + + + A + + + U + + + C + + + A + + + C + + + U + + + C + + + A + + + U + + + A + + + A + + + U + + + G + + + A + + + U + + + G + + + G + + + G + + + G + + + U + + + C + + + A + + + C + + + A + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + A + + + U + + + C + + + C + + + C + + + G + + + U + + + C + + + G + + + U + + + A + + + G + + + C + + + C + + + A + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.json new file mode 100644 index 0000000..21ad611 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.json @@ -0,0 +1,593 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "C", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "C", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "C", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "G", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "G", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "A", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "U", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "C", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 18 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 19 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 20 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 21 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 22 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 23 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 24 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 25 + }, + { + "base": "A", + "x": 133.13, + "y": 80.22, + "pos": 26 + }, + { + "base": "G", + "x": 132.0, + "y": 90.12, + "pos": 27 + }, + { + "base": "G", + "x": 132.0, + "y": 97.68, + "pos": 28 + }, + { + "base": "G", + "x": 132.0, + "y": 105.24, + "pos": 29 + }, + { + "base": "G", + "x": 132.0, + "y": 112.8, + "pos": 30 + }, + { + "base": "A", + "x": 132.0, + "y": 120.36, + "pos": 31 + }, + { + "base": "U", + "x": 123.11, + "y": 127.8, + "pos": 32 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 33 + }, + { + "base": "G", + "x": 130.14, + "y": 136.62, + "pos": 34 + }, + { + "base": "A", + "x": 135.78, + "y": 137.91, + "pos": 35 + }, + { + "base": "A", + "x": 141.42, + "y": 136.62, + "pos": 36 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 37 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 38 + }, + { + "base": "U", + "x": 139.56, + "y": 120.36, + "pos": 39 + }, + { + "base": "C", + "x": 139.56, + "y": 112.8, + "pos": 40 + }, + { + "base": "C", + "x": 139.56, + "y": 105.24, + "pos": 41 + }, + { + "base": "C", + "x": 139.56, + "y": 97.68, + "pos": 42 + }, + { + "base": "C", + "x": 139.56, + "y": 90.12, + "pos": 43 + }, + { + "base": "G", + "x": 143.49, + "y": 81.05, + "pos": 44 + }, + { + "base": "U", + "x": 148.55, + "y": 73.51, + "pos": 45 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 46 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 47 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 48 + }, + { + "base": "C", + "x": 139.06, + "y": 42.56, + "pos": 49 + }, + { + "base": "U", + "x": 131.5, + "y": 42.56, + "pos": 50 + }, + { + "base": "U", + "x": 123.94, + "y": 42.56, + "pos": 51 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 53 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 54 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 55 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 56 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 57 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 58 + }, + { + "base": "U", + "x": 96.16, + "y": 28.62, + "pos": 59 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 60 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 61 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 62 + }, + { + "base": "G", + "x": 123.94, + "y": 35.0, + "pos": 63 + }, + { + "base": "A", + "x": 131.5, + "y": 35.0, + "pos": 64 + }, + { + "base": "G", + "x": 139.06, + "y": 35.0, + "pos": 65 + }, + { + "base": "U", + "x": 149.64, + "y": 35.0, + "pos": 66 + }, + { + "base": "C", + "x": 157.2, + "y": 35.0, + "pos": 67 + }, + { + "base": "C", + "x": 164.76, + "y": 35.0, + "pos": 68 + }, + { + "base": "G", + "x": 172.32, + "y": 35.0, + "pos": 69 + }, + { + "base": "G", + "x": 179.88, + "y": 35.0, + "pos": 70 + }, + { + "base": "G", + "x": 187.44, + "y": 35.0, + "pos": 71 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 72 + }, + { + "base": "A", + "x": 195.0, + "y": 27.44, + "pos": 73 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 75 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 76 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Phe-GAA", + "sequence": "GCCCGGAUAGCUCAGUCGGUAGAGCAGGGGAUUGAAAAUCCCCGUGUCCUUGGUUCGAUUCCGAGUCCGGGCACCA", + "structure": "<<<<<<<..<<<<........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.svg new file mode 100644 index 0000000..f75c896 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.svg @@ -0,0 +1,261 @@ + + + tRNA-Phe-GAA + + + + + + + + + + + + + + + + + + + + + + + + G + + + C + + + C + + + C + + + G + + + G + + + A + + + U + + + A + + + G + + + C + + + U + + + C + + + A + + + G + + + U + + + C + + + G + + + G + + + U + + + A + + + G + + + A + + + G + + + C + + + A + + + G + + + G + + + G + + + G + + + A + + + U + + + U + + + G + + + A + + + A + + + A + + + A + + + U + + + C + + + C + + + C + + + C + + + G + + + U + + + G + + + U + + + C + + + C + + + U + + + U + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + U + + + U + + + C + + + C + + + G + + + A + + + G + + + U + + + C + + + C + + + G + + + G + + + G + + + C + + + A + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.json new file mode 100644 index 0000000..04b2e17 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.json @@ -0,0 +1,599 @@ +{ + "nucleotides": [ + { + "base": "C", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "G", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "G", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "U", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "G", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "A", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "U", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "G", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "G", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "C", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "C", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "U", + "x": 95.64, + "y": 64.34, + "pos": 18 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 19 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 20 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 21 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 22 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 23 + }, + { + "base": "C", + "x": 119.4, + "y": 68.12, + "pos": 24 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 25 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 26 + }, + { + "base": "A", + "x": 133.13, + "y": 80.22, + "pos": 27 + }, + { + "base": "C", + "x": 132.0, + "y": 90.12, + "pos": 28 + }, + { + "base": "U", + "x": 132.0, + "y": 97.68, + "pos": 29 + }, + { + "base": "U", + "x": 132.0, + "y": 105.24, + "pos": 30 + }, + { + "base": "C", + "x": 132.0, + "y": 112.8, + "pos": 31 + }, + { + "base": "G", + "x": 132.0, + "y": 120.36, + "pos": 32 + }, + { + "base": "U", + "x": 123.11, + "y": 127.8, + "pos": 33 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 34 + }, + { + "base": "C", + "x": 130.14, + "y": 136.62, + "pos": 35 + }, + { + "base": "G", + "x": 135.78, + "y": 137.91, + "pos": 36 + }, + { + "base": "G", + "x": 141.42, + "y": 136.62, + "pos": 37 + }, + { + "base": "G", + "x": 145.94, + "y": 133.02, + "pos": 38 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 39 + }, + { + "base": "C", + "x": 139.56, + "y": 120.36, + "pos": 40 + }, + { + "base": "G", + "x": 139.56, + "y": 112.8, + "pos": 41 + }, + { + "base": "A", + "x": 139.56, + "y": 105.24, + "pos": 42 + }, + { + "base": "A", + "x": 139.56, + "y": 97.68, + "pos": 43 + }, + { + "base": "G", + "x": 139.56, + "y": 90.12, + "pos": 44 + }, + { + "base": "G", + "x": 143.49, + "y": 81.05, + "pos": 45 + }, + { + "base": "G", + "x": 148.55, + "y": 73.51, + "pos": 46 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 47 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 48 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 49 + }, + { + "base": "G", + "x": 139.06, + "y": 42.56, + "pos": 50 + }, + { + "base": "G", + "x": 131.5, + "y": 42.56, + "pos": 51 + }, + { + "base": "A", + "x": 123.94, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 53 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 54 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 55 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 56 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 57 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 58 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 59 + }, + { + "base": "A", + "x": 96.16, + "y": 28.62, + "pos": 60 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 61 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 62 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 63 + }, + { + "base": "U", + "x": 123.94, + "y": 35.0, + "pos": 64 + }, + { + "base": "C", + "x": 131.5, + "y": 35.0, + "pos": 65 + }, + { + "base": "U", + "x": 139.06, + "y": 35.0, + "pos": 66 + }, + { + "base": "A", + "x": 149.64, + "y": 35.0, + "pos": 67 + }, + { + "base": "U", + "x": 157.2, + "y": 35.0, + "pos": 68 + }, + { + "base": "C", + "x": 164.76, + "y": 35.0, + "pos": 69 + }, + { + "base": "A", + "x": 172.32, + "y": 35.0, + "pos": 70 + }, + { + "base": "C", + "x": 179.88, + "y": 35.0, + "pos": 71 + }, + { + "base": "C", + "x": 187.44, + "y": 35.0, + "pos": 72 + }, + { + "base": "G", + "x": 195.0, + "y": 35.0, + "pos": 73 + }, + { + "base": "A", + "x": 195.0, + "y": 27.44, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 75 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 76 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 77 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Pro-CGG", + "sequence": "CGGUGAUUGGCGCAGCCUGGUAGCGCACUUCGUUCGGGACGAAGGGGUCGGAGGUUCGAAUCCUCUAUCACCGACCA", + "structure": "<<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.svg new file mode 100644 index 0000000..5333c46 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.svg @@ -0,0 +1,264 @@ + + + tRNA-Pro-CGG + + + + + + + + + + + + + + + + + + + + + + + + C + + + G + + + G + + + U + + + G + + + A + + + U + + + U + + + G + + + G + + + C + + + G + + + C + + + A + + + G + + + C + + + C + + + U + + + G + + + G + + + U + + + A + + + G + + + C + + + G + + + C + + + A + + + C + + + U + + + U + + + C + + + G + + + U + + + U + + + C + + + G + + + G + + + G + + + A + + + C + + + G + + + A + + + A + + + G + + + G + + + G + + + G + + + U + + + C + + + G + + + G + + + A + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + A + + + U + + + C + + + C + + + U + + + C + + + U + + + A + + + U + + + C + + + A + + + C + + + C + + + G + + + A + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.json new file mode 100644 index 0000000..7d2c9ae --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.json @@ -0,0 +1,599 @@ +{ + "nucleotides": [ + { + "base": "C", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "G", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "G", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "C", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "A", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "C", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "G", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "G", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "C", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "C", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "U", + "x": 95.64, + "y": 64.34, + "pos": 18 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 19 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 20 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 21 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 22 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 23 + }, + { + "base": "C", + "x": 119.4, + "y": 68.12, + "pos": 24 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 25 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 26 + }, + { + "base": "A", + "x": 133.13, + "y": 80.22, + "pos": 27 + }, + { + "base": "C", + "x": 132.0, + "y": 90.12, + "pos": 28 + }, + { + "base": "C", + "x": 132.0, + "y": 97.68, + "pos": 29 + }, + { + "base": "G", + "x": 132.0, + "y": 105.24, + "pos": 30 + }, + { + "base": "U", + "x": 132.0, + "y": 112.8, + "pos": 31 + }, + { + "base": "C", + "x": 132.0, + "y": 120.36, + "pos": 32 + }, + { + "base": "A", + "x": 123.11, + "y": 127.8, + "pos": 33 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 34 + }, + { + "base": "G", + "x": 130.14, + "y": 136.62, + "pos": 35 + }, + { + "base": "G", + "x": 135.78, + "y": 137.91, + "pos": 36 + }, + { + "base": "G", + "x": 141.42, + "y": 136.62, + "pos": 37 + }, + { + "base": "G", + "x": 145.94, + "y": 133.02, + "pos": 38 + }, + { + "base": "U", + "x": 148.45, + "y": 127.8, + "pos": 39 + }, + { + "base": "G", + "x": 139.56, + "y": 120.36, + "pos": 40 + }, + { + "base": "U", + "x": 139.56, + "y": 112.8, + "pos": 41 + }, + { + "base": "C", + "x": 139.56, + "y": 105.24, + "pos": 42 + }, + { + "base": "G", + "x": 139.56, + "y": 97.68, + "pos": 43 + }, + { + "base": "G", + "x": 139.56, + "y": 90.12, + "pos": 44 + }, + { + "base": "G", + "x": 143.49, + "y": 81.05, + "pos": 45 + }, + { + "base": "G", + "x": 148.55, + "y": 73.51, + "pos": 46 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 47 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 48 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 49 + }, + { + "base": "G", + "x": 139.06, + "y": 42.56, + "pos": 50 + }, + { + "base": "G", + "x": 131.5, + "y": 42.56, + "pos": 51 + }, + { + "base": "A", + "x": 123.94, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 53 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 54 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 55 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 56 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 57 + }, + { + "base": "A", + "x": 91.27, + "y": 38.78, + "pos": 58 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 59 + }, + { + "base": "A", + "x": 96.16, + "y": 28.62, + "pos": 60 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 61 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 62 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 63 + }, + { + "base": "U", + "x": 123.94, + "y": 35.0, + "pos": 64 + }, + { + "base": "C", + "x": 131.5, + "y": 35.0, + "pos": 65 + }, + { + "base": "U", + "x": 139.06, + "y": 35.0, + "pos": 66 + }, + { + "base": "C", + "x": 149.64, + "y": 35.0, + "pos": 67 + }, + { + "base": "G", + "x": 157.2, + "y": 35.0, + "pos": 68 + }, + { + "base": "U", + "x": 164.76, + "y": 35.0, + "pos": 69 + }, + { + "base": "G", + "x": 172.32, + "y": 35.0, + "pos": 70 + }, + { + "base": "C", + "x": 179.88, + "y": 35.0, + "pos": 71 + }, + { + "base": "C", + "x": 187.44, + "y": 35.0, + "pos": 72 + }, + { + "base": "G", + "x": 195.0, + "y": 35.0, + "pos": 73 + }, + { + "base": "A", + "x": 195.0, + "y": 27.44, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 75 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 76 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 77 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Pro-GGG", + "sequence": "CGGCACGUAGCGCAGCCUGGUAGCGCACCGUCAUGGGGUGUCGGGGGUCGGAGGUUCAAAUCCUCUCGUGCCGACCA", + "structure": "<<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.svg new file mode 100644 index 0000000..ac97dd3 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.svg @@ -0,0 +1,264 @@ + + + tRNA-Pro-GGG + + + + + + + + + + + + + + + + + + + + + + + + C + + + G + + + G + + + C + + + A + + + C + + + G + + + U + + + A + + + G + + + C + + + G + + + C + + + A + + + G + + + C + + + C + + + U + + + G + + + G + + + U + + + A + + + G + + + C + + + G + + + C + + + A + + + C + + + C + + + G + + + U + + + C + + + A + + + U + + + G + + + G + + + G + + + G + + + U + + + G + + + U + + + C + + + G + + + G + + + G + + + G + + + G + + + U + + + C + + + G + + + G + + + A + + + G + + + G + + + U + + + U + + + C + + + A + + + A + + + A + + + U + + + C + + + C + + + U + + + C + + + U + + + C + + + G + + + U + + + G + + + C + + + C + + + G + + + A + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.json new file mode 100644 index 0000000..ff99fe8 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.json @@ -0,0 +1,599 @@ +{ + "nucleotides": [ + { + "base": "C", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "G", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "G", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "C", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "G", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "A", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "G", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "G", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "C", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "U", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "U", + "x": 95.64, + "y": 64.34, + "pos": 18 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 19 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 20 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 21 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 22 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 23 + }, + { + "base": "C", + "x": 119.4, + "y": 68.12, + "pos": 24 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 25 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 26 + }, + { + "base": "A", + "x": 133.13, + "y": 80.22, + "pos": 27 + }, + { + "base": "A", + "x": 132.0, + "y": 90.12, + "pos": 28 + }, + { + "base": "C", + "x": 132.0, + "y": 97.68, + "pos": 29 + }, + { + "base": "U", + "x": 132.0, + "y": 105.24, + "pos": 30 + }, + { + "base": "G", + "x": 132.0, + "y": 112.8, + "pos": 31 + }, + { + "base": "G", + "x": 132.0, + "y": 120.36, + "pos": 32 + }, + { + "base": "U", + "x": 123.11, + "y": 127.8, + "pos": 33 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 34 + }, + { + "base": "U", + "x": 130.14, + "y": 136.62, + "pos": 35 + }, + { + "base": "G", + "x": 135.78, + "y": 137.91, + "pos": 36 + }, + { + "base": "G", + "x": 141.42, + "y": 136.62, + "pos": 37 + }, + { + "base": "G", + "x": 145.94, + "y": 133.02, + "pos": 38 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 39 + }, + { + "base": "C", + "x": 139.56, + "y": 120.36, + "pos": 40 + }, + { + "base": "C", + "x": 139.56, + "y": 112.8, + "pos": 41 + }, + { + "base": "A", + "x": 139.56, + "y": 105.24, + "pos": 42 + }, + { + "base": "G", + "x": 139.56, + "y": 97.68, + "pos": 43 + }, + { + "base": "U", + "x": 139.56, + "y": 90.12, + "pos": 44 + }, + { + "base": "G", + "x": 143.49, + "y": 81.05, + "pos": 45 + }, + { + "base": "G", + "x": 148.55, + "y": 73.51, + "pos": 46 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 47 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 48 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 49 + }, + { + "base": "G", + "x": 139.06, + "y": 42.56, + "pos": 50 + }, + { + "base": "G", + "x": 131.5, + "y": 42.56, + "pos": 51 + }, + { + "base": "A", + "x": 123.94, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 53 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 54 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 55 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 56 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 57 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 58 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 59 + }, + { + "base": "A", + "x": 96.16, + "y": 28.62, + "pos": 60 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 61 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 62 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 63 + }, + { + "base": "U", + "x": 123.94, + "y": 35.0, + "pos": 64 + }, + { + "base": "C", + "x": 131.5, + "y": 35.0, + "pos": 65 + }, + { + "base": "U", + "x": 139.06, + "y": 35.0, + "pos": 66 + }, + { + "base": "C", + "x": 149.64, + "y": 35.0, + "pos": 67 + }, + { + "base": "U", + "x": 157.2, + "y": 35.0, + "pos": 68 + }, + { + "base": "C", + "x": 164.76, + "y": 35.0, + "pos": 69 + }, + { + "base": "G", + "x": 172.32, + "y": 35.0, + "pos": 70 + }, + { + "base": "C", + "x": 179.88, + "y": 35.0, + "pos": 71 + }, + { + "base": "C", + "x": 187.44, + "y": 35.0, + "pos": 72 + }, + { + "base": "G", + "x": 195.0, + "y": 35.0, + "pos": 73 + }, + { + "base": "A", + "x": 195.0, + "y": 27.44, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 75 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 76 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 77 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Pro-TGG", + "sequence": "CGGCGAGUAGCGCAGCUUGGUAGCGCAACUGGUUUGGGACCAGUGGGUCGGAGGUUCGAAUCCUCUCUCGCCGACCA", + "structure": "<<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.svg new file mode 100644 index 0000000..c40a0f6 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.svg @@ -0,0 +1,264 @@ + + + tRNA-Pro-TGG + + + + + + + + + + + + + + + + + + + + + + + + C + + + G + + + G + + + C + + + G + + + A + + + G + + + U + + + A + + + G + + + C + + + G + + + C + + + A + + + G + + + C + + + U + + + U + + + G + + + G + + + U + + + A + + + G + + + C + + + G + + + C + + + A + + + A + + + C + + + U + + + G + + + G + + + U + + + U + + + U + + + G + + + G + + + G + + + A + + + C + + + C + + + A + + + G + + + U + + + G + + + G + + + G + + + U + + + C + + + G + + + G + + + A + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + A + + + U + + + C + + + C + + + U + + + C + + + U + + + C + + + U + + + C + + + G + + + C + + + C + + + G + + + A + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.json new file mode 100644 index 0000000..0f4f66d --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.json @@ -0,0 +1,593 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "C", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "C", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "G", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "A", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "U", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "A", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "U", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "U", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 18 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 19 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 20 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 21 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 22 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 23 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 24 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 25 + }, + { + "base": "A", + "x": 133.13, + "y": 80.22, + "pos": 26 + }, + { + "base": "G", + "x": 132.0, + "y": 90.12, + "pos": 27 + }, + { + "base": "C", + "x": 132.0, + "y": 97.68, + "pos": 28 + }, + { + "base": "G", + "x": 132.0, + "y": 105.24, + "pos": 29 + }, + { + "base": "C", + "x": 132.0, + "y": 112.8, + "pos": 30 + }, + { + "base": "A", + "x": 132.0, + "y": 120.36, + "pos": 31 + }, + { + "base": "U", + "x": 123.11, + "y": 127.8, + "pos": 32 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 33 + }, + { + "base": "C", + "x": 130.14, + "y": 136.62, + "pos": 34 + }, + { + "base": "G", + "x": 135.78, + "y": 137.91, + "pos": 35 + }, + { + "base": "U", + "x": 141.42, + "y": 136.62, + "pos": 36 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 37 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 38 + }, + { + "base": "U", + "x": 139.56, + "y": 120.36, + "pos": 39 + }, + { + "base": "G", + "x": 139.56, + "y": 112.8, + "pos": 40 + }, + { + "base": "C", + "x": 139.56, + "y": 105.24, + "pos": 41 + }, + { + "base": "G", + "x": 139.56, + "y": 97.68, + "pos": 42 + }, + { + "base": "A", + "x": 139.56, + "y": 90.12, + "pos": 43 + }, + { + "base": "A", + "x": 143.49, + "y": 81.05, + "pos": 44 + }, + { + "base": "G", + "x": 148.55, + "y": 73.51, + "pos": 45 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 46 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 47 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 48 + }, + { + "base": "G", + "x": 139.06, + "y": 42.56, + "pos": 49 + }, + { + "base": "U", + "x": 131.5, + "y": 42.56, + "pos": 50 + }, + { + "base": "A", + "x": 123.94, + "y": 42.56, + "pos": 51 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 53 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 54 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 55 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 56 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 57 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 58 + }, + { + "base": "C", + "x": 96.16, + "y": 28.62, + "pos": 59 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 60 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 61 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 62 + }, + { + "base": "U", + "x": 123.94, + "y": 35.0, + "pos": 63 + }, + { + "base": "A", + "x": 131.5, + "y": 35.0, + "pos": 64 + }, + { + "base": "U", + "x": 139.06, + "y": 35.0, + "pos": 65 + }, + { + "base": "U", + "x": 149.64, + "y": 35.0, + "pos": 66 + }, + { + "base": "A", + "x": 157.2, + "y": 35.0, + "pos": 67 + }, + { + "base": "U", + "x": 164.76, + "y": 35.0, + "pos": 68 + }, + { + "base": "C", + "x": 172.32, + "y": 35.0, + "pos": 69 + }, + { + "base": "G", + "x": 179.88, + "y": 35.0, + "pos": 70 + }, + { + "base": "G", + "x": 187.44, + "y": 35.0, + "pos": 71 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 72 + }, + { + "base": "A", + "x": 195.0, + "y": 27.44, + "pos": 73 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 75 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 76 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Thr-CGT", + "sequence": "GCCGAUAUAGCUCAGUUGGUAGAGCAGCGCAUUCGUAAUGCGAAGGUCGUAGGUUCGACUCCUAUUAUCGGCACCA", + "structure": "<<<<<<<..<<<<........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.svg new file mode 100644 index 0000000..a660722 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.svg @@ -0,0 +1,261 @@ + + + tRNA-Thr-CGT + + + + + + + + + + + + + + + + + + + + + + + + G + + + C + + + C + + + G + + + A + + + U + + + A + + + U + + + A + + + G + + + C + + + U + + + C + + + A + + + G + + + U + + + U + + + G + + + G + + + U + + + A + + + G + + + A + + + G + + + C + + + A + + + G + + + C + + + G + + + C + + + A + + + U + + + U + + + C + + + G + + + U + + + A + + + A + + + U + + + G + + + C + + + G + + + A + + + A + + + G + + + G + + + U + + + C + + + G + + + U + + + A + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + C + + + U + + + C + + + C + + + U + + + A + + + U + + + U + + + A + + + U + + + C + + + G + + + G + + + C + + + A + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.json new file mode 100644 index 0000000..b1a58eb --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.json @@ -0,0 +1,593 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "C", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "U", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "G", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "A", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "U", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "A", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "U", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "U", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 18 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 19 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 20 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 21 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 22 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 23 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 24 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 25 + }, + { + "base": "G", + "x": 133.13, + "y": 80.22, + "pos": 26 + }, + { + "base": "C", + "x": 132.0, + "y": 90.12, + "pos": 27 + }, + { + "base": "A", + "x": 132.0, + "y": 97.68, + "pos": 28 + }, + { + "base": "C", + "x": 132.0, + "y": 105.24, + "pos": 29 + }, + { + "base": "C", + "x": 132.0, + "y": 112.8, + "pos": 30 + }, + { + "base": "C", + "x": 132.0, + "y": 120.36, + "pos": 31 + }, + { + "base": "U", + "x": 123.11, + "y": 127.8, + "pos": 32 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 33 + }, + { + "base": "G", + "x": 130.14, + "y": 136.62, + "pos": 34 + }, + { + "base": "G", + "x": 135.78, + "y": 137.91, + "pos": 35 + }, + { + "base": "U", + "x": 141.42, + "y": 136.62, + "pos": 36 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 37 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 38 + }, + { + "base": "G", + "x": 139.56, + "y": 120.36, + "pos": 39 + }, + { + "base": "G", + "x": 139.56, + "y": 112.8, + "pos": 40 + }, + { + "base": "G", + "x": 139.56, + "y": 105.24, + "pos": 41 + }, + { + "base": "U", + "x": 139.56, + "y": 97.68, + "pos": 42 + }, + { + "base": "G", + "x": 139.56, + "y": 90.12, + "pos": 43 + }, + { + "base": "A", + "x": 143.49, + "y": 81.05, + "pos": 44 + }, + { + "base": "G", + "x": 148.55, + "y": 73.51, + "pos": 45 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 46 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 47 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 48 + }, + { + "base": "G", + "x": 139.06, + "y": 42.56, + "pos": 49 + }, + { + "base": "G", + "x": 131.5, + "y": 42.56, + "pos": 50 + }, + { + "base": "C", + "x": 123.94, + "y": 42.56, + "pos": 51 + }, + { + "base": "A", + "x": 116.38, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 53 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 54 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 55 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 56 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 57 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 58 + }, + { + "base": "A", + "x": 96.16, + "y": 28.62, + "pos": 59 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 60 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 61 + }, + { + "base": "U", + "x": 116.38, + "y": 35.0, + "pos": 62 + }, + { + "base": "G", + "x": 123.94, + "y": 35.0, + "pos": 63 + }, + { + "base": "C", + "x": 131.5, + "y": 35.0, + "pos": 64 + }, + { + "base": "C", + "x": 139.06, + "y": 35.0, + "pos": 65 + }, + { + "base": "U", + "x": 149.64, + "y": 35.0, + "pos": 66 + }, + { + "base": "A", + "x": 157.2, + "y": 35.0, + "pos": 67 + }, + { + "base": "U", + "x": 164.76, + "y": 35.0, + "pos": 68 + }, + { + "base": "C", + "x": 172.32, + "y": 35.0, + "pos": 69 + }, + { + "base": "A", + "x": 179.88, + "y": 35.0, + "pos": 70 + }, + { + "base": "G", + "x": 187.44, + "y": 35.0, + "pos": 71 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 72 + }, + { + "base": "A", + "x": 195.0, + "y": 27.44, + "pos": 73 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 75 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 76 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Thr-GGT", + "sequence": "GCUGAUAUAGCUCAGUUGGUAGAGCGCACCCUUGGUAAGGGUGAGGUCGGCAGUUCGAAUCUGCCUAUCAGCACCA", + "structure": "<<<<<<<..<<<<........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.svg new file mode 100644 index 0000000..472da5a --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.svg @@ -0,0 +1,261 @@ + + + tRNA-Thr-GGT + + + + + + + + + + + + + + + + + + + + + + + + G + + + C + + + U + + + G + + + A + + + U + + + A + + + U + + + A + + + G + + + C + + + U + + + C + + + A + + + G + + + U + + + U + + + G + + + G + + + U + + + A + + + G + + + A + + + G + + + C + + + G + + + C + + + A + + + C + + + C + + + C + + + U + + + U + + + G + + + G + + + U + + + A + + + A + + + G + + + G + + + G + + + U + + + G + + + A + + + G + + + G + + + U + + + C + + + G + + + G + + + C + + + A + + + G + + + U + + + U + + + C + + + G + + + A + + + A + + + U + + + C + + + U + + + G + + + C + + + C + + + U + + + A + + + U + + + C + + + A + + + G + + + C + + + A + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.json new file mode 100644 index 0000000..32db0be --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.json @@ -0,0 +1,593 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "C", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "C", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "G", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "A", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "C", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "U", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "U", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "A", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 18 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 19 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 20 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 21 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 22 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 23 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 24 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 25 + }, + { + "base": "A", + "x": 133.13, + "y": 80.22, + "pos": 26 + }, + { + "base": "A", + "x": 132.0, + "y": 90.12, + "pos": 27 + }, + { + "base": "C", + "x": 132.0, + "y": 97.68, + "pos": 28 + }, + { + "base": "U", + "x": 132.0, + "y": 105.24, + "pos": 29 + }, + { + "base": "G", + "x": 132.0, + "y": 112.8, + "pos": 30 + }, + { + "base": "A", + "x": 132.0, + "y": 120.36, + "pos": 31 + }, + { + "base": "C", + "x": 123.11, + "y": 127.8, + "pos": 32 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 33 + }, + { + "base": "U", + "x": 130.14, + "y": 136.62, + "pos": 34 + }, + { + "base": "G", + "x": 135.78, + "y": 137.91, + "pos": 35 + }, + { + "base": "U", + "x": 141.42, + "y": 136.62, + "pos": 36 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 37 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 38 + }, + { + "base": "U", + "x": 139.56, + "y": 120.36, + "pos": 39 + }, + { + "base": "C", + "x": 139.56, + "y": 112.8, + "pos": 40 + }, + { + "base": "A", + "x": 139.56, + "y": 105.24, + "pos": 41 + }, + { + "base": "G", + "x": 139.56, + "y": 97.68, + "pos": 42 + }, + { + "base": "U", + "x": 139.56, + "y": 90.12, + "pos": 43 + }, + { + "base": "A", + "x": 143.49, + "y": 81.05, + "pos": 44 + }, + { + "base": "G", + "x": 148.55, + "y": 73.51, + "pos": 45 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 46 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 47 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 48 + }, + { + "base": "A", + "x": 139.06, + "y": 42.56, + "pos": 49 + }, + { + "base": "C", + "x": 131.5, + "y": 42.56, + "pos": 50 + }, + { + "base": "C", + "x": 123.94, + "y": 42.56, + "pos": 51 + }, + { + "base": "A", + "x": 116.38, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 53 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 54 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 55 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 56 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 57 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 58 + }, + { + "base": "U", + "x": 96.16, + "y": 28.62, + "pos": 59 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 60 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 61 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 62 + }, + { + "base": "G", + "x": 123.94, + "y": 35.0, + "pos": 63 + }, + { + "base": "G", + "x": 131.5, + "y": 35.0, + "pos": 64 + }, + { + "base": "U", + "x": 139.06, + "y": 35.0, + "pos": 65 + }, + { + "base": "A", + "x": 149.64, + "y": 35.0, + "pos": 66 + }, + { + "base": "G", + "x": 157.2, + "y": 35.0, + "pos": 67 + }, + { + "base": "U", + "x": 164.76, + "y": 35.0, + "pos": 68 + }, + { + "base": "C", + "x": 172.32, + "y": 35.0, + "pos": 69 + }, + { + "base": "G", + "x": 179.88, + "y": 35.0, + "pos": 70 + }, + { + "base": "G", + "x": 187.44, + "y": 35.0, + "pos": 71 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 72 + }, + { + "base": "A", + "x": 195.0, + "y": 27.44, + "pos": 73 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 75 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 76 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Thr-TGT", + "sequence": "GCCGACUUAGCUCAGUAGGUAGAGCAACUGACUUGUAAUCAGUAGGUCACCAGUUCGAUUCCGGUAGUCGGCACCA", + "structure": "<<<<<<<..<<<<........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.svg new file mode 100644 index 0000000..52e8743 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.svg @@ -0,0 +1,261 @@ + + + tRNA-Thr-TGT + + + + + + + + + + + + + + + + + + + + + + + + G + + + C + + + C + + + G + + + A + + + C + + + U + + + U + + + A + + + G + + + C + + + U + + + C + + + A + + + G + + + U + + + A + + + G + + + G + + + U + + + A + + + G + + + A + + + G + + + C + + + A + + + A + + + C + + + U + + + G + + + A + + + C + + + U + + + U + + + G + + + U + + + A + + + A + + + U + + + C + + + A + + + G + + + U + + + A + + + G + + + G + + + U + + + C + + + A + + + C + + + C + + + A + + + G + + + U + + + U + + + C + + + G + + + A + + + U + + + U + + + C + + + C + + + G + + + G + + + U + + + A + + + G + + + U + + + C + + + G + + + G + + + C + + + A + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.json new file mode 100644 index 0000000..314c4dc --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.json @@ -0,0 +1,593 @@ +{ + "nucleotides": [ + { + "base": "A", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "G", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "G", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "G", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "G", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "C", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "G", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "U", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "A", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "U", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "U", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 18 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 19 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 20 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 21 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 22 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 23 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 24 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 25 + }, + { + "base": "A", + "x": 133.13, + "y": 80.22, + "pos": 26 + }, + { + "base": "C", + "x": 132.0, + "y": 90.12, + "pos": 27 + }, + { + "base": "C", + "x": 132.0, + "y": 97.68, + "pos": 28 + }, + { + "base": "G", + "x": 132.0, + "y": 105.24, + "pos": 29 + }, + { + "base": "G", + "x": 132.0, + "y": 112.8, + "pos": 30 + }, + { + "base": "U", + "x": 132.0, + "y": 120.36, + "pos": 31 + }, + { + "base": "C", + "x": 123.11, + "y": 127.8, + "pos": 32 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 33 + }, + { + "base": "C", + "x": 130.14, + "y": 136.62, + "pos": 34 + }, + { + "base": "C", + "x": 135.78, + "y": 137.91, + "pos": 35 + }, + { + "base": "A", + "x": 141.42, + "y": 136.62, + "pos": 36 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 37 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 38 + }, + { + "base": "A", + "x": 139.56, + "y": 120.36, + "pos": 39 + }, + { + "base": "C", + "x": 139.56, + "y": 112.8, + "pos": 40 + }, + { + "base": "C", + "x": 139.56, + "y": 105.24, + "pos": 41 + }, + { + "base": "G", + "x": 139.56, + "y": 97.68, + "pos": 42 + }, + { + "base": "G", + "x": 139.56, + "y": 90.12, + "pos": 43 + }, + { + "base": "G", + "x": 143.49, + "y": 81.05, + "pos": 44 + }, + { + "base": "U", + "x": 148.55, + "y": 73.51, + "pos": 45 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 46 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 47 + }, + { + "base": "U", + "x": 141.27, + "y": 50.87, + "pos": 48 + }, + { + "base": "G", + "x": 139.06, + "y": 42.56, + "pos": 49 + }, + { + "base": "G", + "x": 131.5, + "y": 42.56, + "pos": 50 + }, + { + "base": "G", + "x": 123.94, + "y": 42.56, + "pos": 51 + }, + { + "base": "A", + "x": 116.38, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 53 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 54 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 55 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 56 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 57 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 58 + }, + { + "base": "G", + "x": 96.16, + "y": 28.62, + "pos": 59 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 60 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 61 + }, + { + "base": "U", + "x": 116.38, + "y": 35.0, + "pos": 62 + }, + { + "base": "C", + "x": 123.94, + "y": 35.0, + "pos": 63 + }, + { + "base": "U", + "x": 131.5, + "y": 35.0, + "pos": 64 + }, + { + "base": "C", + "x": 139.06, + "y": 35.0, + "pos": 65 + }, + { + "base": "C", + "x": 149.64, + "y": 35.0, + "pos": 66 + }, + { + "base": "G", + "x": 157.2, + "y": 35.0, + "pos": 67 + }, + { + "base": "C", + "x": 164.76, + "y": 35.0, + "pos": 68 + }, + { + "base": "C", + "x": 172.32, + "y": 35.0, + "pos": 69 + }, + { + "base": "C", + "x": 179.88, + "y": 35.0, + "pos": 70 + }, + { + "base": "C", + "x": 187.44, + "y": 35.0, + "pos": 71 + }, + { + "base": "U", + "x": 195.0, + "y": 35.0, + "pos": 72 + }, + { + "base": "G", + "x": 195.0, + "y": 27.44, + "pos": 73 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 75 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 76 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Trp-CCA", + "sequence": "AGGGGCGUAGUUCAAUUGGUAGAGCACCGGUCUCCAAAACCGGGUGUUGGGAGUUCGAGUCUCUCCGCCCCUGCCA", + "structure": "<<<<<<<..<<<<........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.svg new file mode 100644 index 0000000..49e7c87 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.svg @@ -0,0 +1,261 @@ + + + tRNA-Trp-CCA + + + + + + + + + + + + + + + + + + + + + + + + A + + + G + + + G + + + G + + + G + + + C + + + G + + + U + + + A + + + G + + + U + + + U + + + C + + + A + + + A + + + U + + + U + + + G + + + G + + + U + + + A + + + G + + + A + + + G + + + C + + + A + + + C + + + C + + + G + + + G + + + U + + + C + + + U + + + C + + + C + + + A + + + A + + + A + + + A + + + C + + + C + + + G + + + G + + + G + + + U + + + G + + + U + + + U + + + G + + + G + + + G + + + A + + + G + + + U + + + U + + + C + + + G + + + A + + + G + + + U + + + C + + + U + + + C + + + U + + + C + + + C + + + G + + + C + + + C + + + C + + + C + + + U + + + G + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.json new file mode 100644 index 0000000..66231ae --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.json @@ -0,0 +1,599 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "C", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "G", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "U", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "C", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "C", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "G", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "U", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "U", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 18 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 19 + }, + { + "base": "U", + "x": 100.97, + "y": 54.36, + "pos": 20 + }, + { + "base": "U", + "x": 102.19, + "y": 53.65, + "pos": 21 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 22 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 23 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 24 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 25 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 26 + }, + { + "base": "A", + "x": 133.13, + "y": 80.22, + "pos": 27 + }, + { + "base": "C", + "x": 132.0, + "y": 90.12, + "pos": 28 + }, + { + "base": "C", + "x": 132.0, + "y": 97.68, + "pos": 29 + }, + { + "base": "A", + "x": 132.0, + "y": 105.24, + "pos": 30 + }, + { + "base": "C", + "x": 132.0, + "y": 112.8, + "pos": 31 + }, + { + "base": "C", + "x": 132.0, + "y": 120.36, + "pos": 32 + }, + { + "base": "U", + "x": 123.11, + "y": 127.8, + "pos": 33 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 34 + }, + { + "base": "G", + "x": 130.14, + "y": 136.62, + "pos": 35 + }, + { + "base": "A", + "x": 135.78, + "y": 137.91, + "pos": 36 + }, + { + "base": "C", + "x": 141.42, + "y": 136.62, + "pos": 37 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 38 + }, + { + "base": "U", + "x": 148.45, + "y": 127.8, + "pos": 39 + }, + { + "base": "G", + "x": 139.56, + "y": 120.36, + "pos": 40 + }, + { + "base": "G", + "x": 139.56, + "y": 112.8, + "pos": 41 + }, + { + "base": "U", + "x": 139.56, + "y": 105.24, + "pos": 42 + }, + { + "base": "G", + "x": 139.56, + "y": 97.68, + "pos": 43 + }, + { + "base": "G", + "x": 139.56, + "y": 90.12, + "pos": 44 + }, + { + "base": "G", + "x": 143.49, + "y": 81.05, + "pos": 45 + }, + { + "base": "G", + "x": 148.55, + "y": 73.51, + "pos": 46 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 47 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 48 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 49 + }, + { + "base": "G", + "x": 139.06, + "y": 42.56, + "pos": 50 + }, + { + "base": "G", + "x": 131.5, + "y": 42.56, + "pos": 51 + }, + { + "base": "U", + "x": 123.94, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 53 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 54 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 55 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 56 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 57 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 58 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 59 + }, + { + "base": "G", + "x": 96.16, + "y": 28.62, + "pos": 60 + }, + { + "base": "U", + "x": 101.37, + "y": 26.11, + "pos": 61 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 62 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 63 + }, + { + "base": "A", + "x": 123.94, + "y": 35.0, + "pos": 64 + }, + { + "base": "C", + "x": 131.5, + "y": 35.0, + "pos": 65 + }, + { + "base": "U", + "x": 139.06, + "y": 35.0, + "pos": 66 + }, + { + "base": "C", + "x": 149.64, + "y": 35.0, + "pos": 67 + }, + { + "base": "G", + "x": 157.2, + "y": 35.0, + "pos": 68 + }, + { + "base": "G", + "x": 164.76, + "y": 35.0, + "pos": 69 + }, + { + "base": "A", + "x": 172.32, + "y": 35.0, + "pos": 70 + }, + { + "base": "C", + "x": 179.88, + "y": 35.0, + "pos": 71 + }, + { + "base": "G", + "x": 187.44, + "y": 35.0, + "pos": 72 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 73 + }, + { + "base": "A", + "x": 195.0, + "y": 27.44, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 75 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 76 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 77 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Val-GAC", + "sequence": "GCGUCCGUAGCUCAGUUGGUUAGAGCACCACCUUGACAUGGUGGGGGUCGGUGGUUCGAGUCCACUCGGACGCACCA", + "structure": "<<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.svg new file mode 100644 index 0000000..46a99fd --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.svg @@ -0,0 +1,264 @@ + + + tRNA-Val-GAC + + + + + + + + + + + + + + + + + + + + + + + + G + + + C + + + G + + + U + + + C + + + C + + + G + + + U + + + A + + + G + + + C + + + U + + + C + + + A + + + G + + + U + + + U + + + G + + + G + + + U + + + U + + + A + + + G + + + A + + + G + + + C + + + A + + + C + + + C + + + A + + + C + + + C + + + U + + + U + + + G + + + A + + + C + + + A + + + U + + + G + + + G + + + U + + + G + + + G + + + G + + + G + + + G + + + U + + + C + + + G + + + G + + + U + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + G + + + U + + + C + + + C + + + A + + + C + + + U + + + C + + + G + + + G + + + A + + + C + + + G + + + C + + + A + + + C + + + C + + + A + + diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.json new file mode 100644 index 0000000..e117712 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.json @@ -0,0 +1,593 @@ +{ + "nucleotides": [ + { + "base": "G", + "x": 195.0, + "y": 42.56, + "pos": 1 + }, + { + "base": "G", + "x": 187.44, + "y": 42.56, + "pos": 2 + }, + { + "base": "G", + "x": 179.88, + "y": 42.56, + "pos": 3 + }, + { + "base": "U", + "x": 172.32, + "y": 42.56, + "pos": 4 + }, + { + "base": "G", + "x": 164.76, + "y": 42.56, + "pos": 5 + }, + { + "base": "A", + "x": 157.2, + "y": 42.56, + "pos": 6 + }, + { + "base": "U", + "x": 149.64, + "y": 42.56, + "pos": 7 + }, + { + "base": "U", + "x": 146.62, + "y": 49.76, + "pos": 8 + }, + { + "base": "A", + "x": 139.81, + "y": 56.96, + "pos": 9 + }, + { + "base": "G", + "x": 134.52, + "y": 60.56, + "pos": 10 + }, + { + "base": "C", + "x": 126.96, + "y": 60.56, + "pos": 11 + }, + { + "base": "U", + "x": 119.4, + "y": 60.56, + "pos": 12 + }, + { + "base": "C", + "x": 111.84, + "y": 60.56, + "pos": 13 + }, + { + "base": "A", + "x": 105.3, + "y": 76.11, + "pos": 14 + }, + { + "base": "G", + "x": 100.97, + "y": 74.32, + "pos": 15 + }, + { + "base": "C", + "x": 97.66, + "y": 71.01, + "pos": 16 + }, + { + "base": "U", + "x": 95.87, + "y": 66.68, + "pos": 17 + }, + { + "base": "G", + "x": 95.87, + "y": 62.0, + "pos": 18 + }, + { + "base": "G", + "x": 97.66, + "y": 57.67, + "pos": 19 + }, + { + "base": "G", + "x": 100.97, + "y": 54.36, + "pos": 20 + }, + { + "base": "A", + "x": 105.3, + "y": 52.57, + "pos": 21 + }, + { + "base": "G", + "x": 111.84, + "y": 68.12, + "pos": 22 + }, + { + "base": "A", + "x": 119.4, + "y": 68.12, + "pos": 23 + }, + { + "base": "G", + "x": 126.96, + "y": 68.12, + "pos": 24 + }, + { + "base": "C", + "x": 134.52, + "y": 68.12, + "pos": 25 + }, + { + "base": "A", + "x": 133.13, + "y": 80.22, + "pos": 26 + }, + { + "base": "C", + "x": 132.0, + "y": 90.12, + "pos": 27 + }, + { + "base": "C", + "x": 132.0, + "y": 97.68, + "pos": 28 + }, + { + "base": "U", + "x": 132.0, + "y": 105.24, + "pos": 29 + }, + { + "base": "C", + "x": 132.0, + "y": 112.8, + "pos": 30 + }, + { + "base": "C", + "x": 132.0, + "y": 120.36, + "pos": 31 + }, + { + "base": "C", + "x": 123.11, + "y": 127.8, + "pos": 32 + }, + { + "base": "U", + "x": 125.62, + "y": 133.02, + "pos": 33 + }, + { + "base": "U", + "x": 130.14, + "y": 136.62, + "pos": 34 + }, + { + "base": "A", + "x": 135.78, + "y": 137.91, + "pos": 35 + }, + { + "base": "C", + "x": 141.42, + "y": 136.62, + "pos": 36 + }, + { + "base": "A", + "x": 145.94, + "y": 133.02, + "pos": 37 + }, + { + "base": "A", + "x": 148.45, + "y": 127.8, + "pos": 38 + }, + { + "base": "G", + "x": 139.56, + "y": 120.36, + "pos": 39 + }, + { + "base": "G", + "x": 139.56, + "y": 112.8, + "pos": 40 + }, + { + "base": "A", + "x": 139.56, + "y": 105.24, + "pos": 41 + }, + { + "base": "G", + "x": 139.56, + "y": 97.68, + "pos": 42 + }, + { + "base": "G", + "x": 139.56, + "y": 90.12, + "pos": 43 + }, + { + "base": "G", + "x": 143.49, + "y": 81.05, + "pos": 44 + }, + { + "base": "G", + "x": 148.55, + "y": 73.51, + "pos": 45 + }, + { + "base": "G", + "x": 149.87, + "y": 65.96, + "pos": 46 + }, + { + "base": "U", + "x": 147.44, + "y": 58.42, + "pos": 47 + }, + { + "base": "C", + "x": 141.27, + "y": 50.87, + "pos": 48 + }, + { + "base": "G", + "x": 139.06, + "y": 42.56, + "pos": 49 + }, + { + "base": "G", + "x": 131.5, + "y": 42.56, + "pos": 50 + }, + { + "base": "C", + "x": 123.94, + "y": 42.56, + "pos": 51 + }, + { + "base": "G", + "x": 116.38, + "y": 42.56, + "pos": 52 + }, + { + "base": "G", + "x": 108.82, + "y": 42.56, + "pos": 53 + }, + { + "base": "U", + "x": 101.37, + "y": 51.45, + "pos": 54 + }, + { + "base": "U", + "x": 96.16, + "y": 48.94, + "pos": 55 + }, + { + "base": "C", + "x": 92.55, + "y": 44.42, + "pos": 56 + }, + { + "base": "G", + "x": 91.27, + "y": 38.78, + "pos": 57 + }, + { + "base": "A", + "x": 92.55, + "y": 33.14, + "pos": 58 + }, + { + "base": "U", + "x": 96.16, + "y": 28.62, + "pos": 59 + }, + { + "base": "C", + "x": 101.37, + "y": 26.11, + "pos": 60 + }, + { + "base": "C", + "x": 108.82, + "y": 35.0, + "pos": 61 + }, + { + "base": "C", + "x": 116.38, + "y": 35.0, + "pos": 62 + }, + { + "base": "G", + "x": 123.94, + "y": 35.0, + "pos": 63 + }, + { + "base": "U", + "x": 131.5, + "y": 35.0, + "pos": 64 + }, + { + "base": "C", + "x": 139.06, + "y": 35.0, + "pos": 65 + }, + { + "base": "A", + "x": 149.64, + "y": 35.0, + "pos": 66 + }, + { + "base": "U", + "x": 157.2, + "y": 35.0, + "pos": 67 + }, + { + "base": "C", + "x": 164.76, + "y": 35.0, + "pos": 68 + }, + { + "base": "A", + "x": 172.32, + "y": 35.0, + "pos": 69 + }, + { + "base": "C", + "x": 179.88, + "y": 35.0, + "pos": 70 + }, + { + "base": "C", + "x": 187.44, + "y": 35.0, + "pos": 71 + }, + { + "base": "C", + "x": 195.0, + "y": 35.0, + "pos": 72 + }, + { + "base": "A", + "x": 195.0, + "y": 27.44, + "pos": 73 + }, + { + "base": "C", + "x": 195.0, + "y": 19.88, + "pos": 74 + }, + { + "base": "C", + "x": 195.0, + "y": 12.32, + "pos": 75 + }, + { + "base": "A", + "x": 195.0, + "y": 4.76, + "pos": 76 + } + ], + "width": 215.0, + "height": 157.91, + "lines": [ + { + "x1": 197.38, + "y1": 37.5, + "x2": 197.38, + "y2": 34.94 + }, + { + "x1": 189.81, + "y1": 37.5, + "x2": 189.81, + "y2": 34.94 + }, + { + "x1": 182.25, + "y1": 37.5, + "x2": 182.25, + "y2": 34.94 + }, + { + "x1": 174.69, + "y1": 37.5, + "x2": 174.69, + "y2": 34.94 + }, + { + "x1": 167.13, + "y1": 37.5, + "x2": 167.13, + "y2": 34.94 + }, + { + "x1": 159.57, + "y1": 37.5, + "x2": 159.57, + "y2": 34.94 + }, + { + "x1": 152.01, + "y1": 37.5, + "x2": 152.01, + "y2": 34.94 + }, + { + "x1": 136.89, + "y1": 60.5, + "x2": 136.89, + "y2": 63.06 + }, + { + "x1": 129.33, + "y1": 60.5, + "x2": 129.33, + "y2": 63.06 + }, + { + "x1": 121.77, + "y1": 60.5, + "x2": 121.77, + "y2": 63.06 + }, + { + "x1": 114.21, + "y1": 60.5, + "x2": 114.21, + "y2": 63.06 + }, + { + "x1": 136.88, + "y1": 87.56, + "x2": 139.44, + "y2": 87.56 + }, + { + "x1": 136.88, + "y1": 95.12, + "x2": 139.44, + "y2": 95.12 + }, + { + "x1": 136.88, + "y1": 102.68, + "x2": 139.44, + "y2": 102.68 + }, + { + "x1": 136.88, + "y1": 110.24, + "x2": 139.44, + "y2": 110.24 + }, + { + "x1": 136.88, + "y1": 117.8, + "x2": 139.44, + "y2": 117.8 + }, + { + "x1": 141.43, + "y1": 37.5, + "x2": 141.43, + "y2": 34.94 + }, + { + "x1": 133.87, + "y1": 37.5, + "x2": 133.87, + "y2": 34.94 + }, + { + "x1": 126.31, + "y1": 37.5, + "x2": 126.31, + "y2": 34.94 + }, + { + "x1": 118.75, + "y1": 37.5, + "x2": 118.75, + "y2": 34.94 + }, + { + "x1": 111.19, + "y1": 37.5, + "x2": 111.19, + "y2": 34.94 + } + ], + "trna_name": "tRNA-Val-TAC", + "sequence": "GGGUGAUUAGCUCAGCUGGGAGAGCACCUCCCUUACAAGGAGGGGGUCGGCGGUUCGAUCCCGUCAUCACCCACCA", + "structure": "<<<<<<<..<<<<........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...." +} \ No newline at end of file diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.svg new file mode 100644 index 0000000..5c51067 --- /dev/null +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.svg @@ -0,0 +1,261 @@ + + + tRNA-Val-TAC + + + + + + + + + + + + + + + + + + + + + + + + G + + + G + + + G + + + U + + + G + + + A + + + U + + + U + + + A + + + G + + + C + + + U + + + C + + + A + + + G + + + C + + + U + + + G + + + G + + + G + + + A + + + G + + + A + + + G + + + C + + + A + + + C + + + C + + + U + + + C + + + C + + + C + + + U + + + U + + + A + + + C + + + A + + + A + + + G + + + G + + + A + + + G + + + G + + + G + + + G + + + G + + + U + + + C + + + G + + + G + + + C + + + G + + + G + + + U + + + U + + + C + + + G + + + A + + + U + + + C + + + C + + + C + + + G + + + U + + + C + + + A + + + U + + + C + + + A + + + C + + + C + + + C + + + A + + + C + + + C + + + A + + diff --git a/man/plot_tRNA_structure.Rd b/man/plot_tRNA_structure.Rd index 36ed9b6..65f2be1 100644 --- a/man/plot_tRNA_structure.Rd +++ b/man/plot_tRNA_structure.Rd @@ -15,7 +15,8 @@ plot_tRNA_structure( outline_palette = NULL, text_colors = NULL, position_markers = TRUE, - linkage_palette = c("#0072B2", "#D55E00") + linkage_palette = c("#0072B2", "#D55E00"), + layout = c("cloverleaf", "elbow") ) } \arguments{ @@ -64,6 +65,13 @@ colors for negative (exclusive) and positive (co-occurring) linkage values. Default \code{c("#0072B2", "#D55E00")} (blue for exclusive, vermillion for co-occurring). Stroke width encodes the magnitude of the value.} + +\item{layout}{One of \code{"cloverleaf"} (default) or \code{"elbow"}. +\code{"elbow"} renders the L-shaped depiction with the acceptor stem +and T-arm stacked coaxially at the top, the D-arm extending +horizontally, and the anticodon arm hanging vertically. The +elbow form is currently available for E. coli standard +3-arm tRNAs.} } \value{ The path to the annotated SVG file (invisibly). @@ -78,5 +86,6 @@ linkages are drawn as Bezier curve arcs between position pairs. \examples{ \donttest{ plot_tRNA_structure("tRNA-Glu-TTC", "Escherichia coli") +plot_tRNA_structure("tRNA-Phe-GAA", "Escherichia coli", layout = "elbow") } } diff --git a/man/structure_trnas.Rd b/man/structure_trnas.Rd index 2c7764c..576722f 100644 --- a/man/structure_trnas.Rd +++ b/man/structure_trnas.Rd @@ -4,20 +4,24 @@ \alias{structure_trnas} \title{List available tRNA structures for an organism} \usage{ -structure_trnas(organism) +structure_trnas(organism, layout = c("cloverleaf", "elbow")) } \arguments{ \item{organism}{Character string specifying the organism name (e.g., \code{"Escherichia coli"}). Use \code{\link[=structure_organisms]{structure_organisms()}} to list available organisms.} + +\item{layout}{One of \code{"cloverleaf"} (default) or \code{"elbow"}. The +elbow form is currently bundled for E. coli standard tRNAs only.} } \value{ A character vector of tRNA names. } \description{ -Returns the names of tRNAs for which cloverleaf structure SVGs -are bundled with the package for the given organism. +Returns the names of tRNAs for which structure SVGs are bundled with +the package for the given organism and layout. } \examples{ structure_trnas("Escherichia coli") +structure_trnas("Escherichia coli", layout = "elbow") } diff --git a/tests/testthat/_snaps/plot-structure.md b/tests/testthat/_snaps/plot-structure.md index 11a38c1..ca9f762 100644 --- a/tests/testthat/_snaps/plot-structure.md +++ b/tests/testthat/_snaps/plot-structure.md @@ -22,22 +22,23 @@ plot_tRNA_structure("tRNA-Fake-XXX", org) Condition Error in `plot_tRNA_structure()`: - ! No structure SVG found for "tRNA-Fake-XXX". - i Use `structure_trnas()` to list available tRNAs. + ! No cloverleaf structure SVG found for "tRNA-Fake-XXX". + i Use `structure_trnas("Escherichia coli", layout = "cloverleaf")` to list available tRNAs. -# structure_to_png errors for missing file +# structure_html errors on missing file Code - structure_to_png("nonexistent.svg") + structure_html("nonexistent.svg") Condition - Error in `structure_to_png()`: + Error in `structure_html()`: ! SVG file not found: 'nonexistent.svg'. -# structure_html errors on missing file +# plot_tRNA_structure(layout = 'elbow') errors clearly when missing Code - structure_html("nonexistent.svg") + plot_tRNA_structure("tRNA-Leu-CAA", "Escherichia coli", layout = "elbow") Condition - Error in `structure_html()`: - ! SVG file not found: 'nonexistent.svg'. + Error in `plot_tRNA_structure()`: + ! No elbow structure SVG found for "tRNA-Leu-CAA". + i Use `structure_trnas("Escherichia coli", layout = "elbow")` to list available tRNAs. diff --git a/tests/testthat/test-plot-structure.R b/tests/testthat/test-plot-structure.R index 083ec9b..0389d9a 100644 --- a/tests/testthat/test-plot-structure.R +++ b/tests/testthat/test-plot-structure.R @@ -291,3 +291,53 @@ test_that("plot_tRNA_structure respects position_markers = FALSE", { end_labels <- xml2::xml_find_first(doc, ".//*[@id='clover-end-labels']") expect_false(is.na(end_labels)) }) + +# Elbow layout ---------------------------------------------------------------- + +test_that("structure_trnas(layout = 'elbow') lists bundled elbow tRNAs", { + trnas <- structure_trnas("Escherichia coli", layout = "elbow") + expect_type(trnas, "character") + expect_true(length(trnas) > 0) + # variable-arm tRNAs (Leu, Ser, SeC) are deferred to v2 + expect_false(any(grepl("^tRNA-(Leu|Ser|SeC)-", trnas))) +}) + +test_that("plot_tRNA_structure renders elbow layout SVG", { + trnas <- structure_trnas("Escherichia coli", layout = "elbow") + skip_if(length(trnas) == 0, "No bundled elbow structures") + out <- plot_tRNA_structure( + "tRNA-Phe-GAA", + "Escherichia coli", + layout = "elbow" + ) + expect_true(file.exists(out)) + doc <- xml2::read_xml(out) + texts <- xml2::xml_find_all(doc, ".//*[local-name()='text']") + expect_true(length(texts) > 70) # 76 nucleotides plus title +}) + +test_that("plot_tRNA_structure(layout = 'elbow') errors clearly when missing", { + expect_snapshot( + plot_tRNA_structure( + "tRNA-Leu-CAA", + "Escherichia coli", + layout = "elbow" + ), + error = TRUE + ) +}) + +test_that("plot_tRNA_structure(layout = 'elbow') applies modification overlay", { + trnas <- structure_trnas("Escherichia coli", layout = "elbow") + skip_if(length(trnas) == 0, "No bundled elbow structures") + mods <- dplyr::tibble(pos = c(34L, 37L), mod1 = c("m1A", "m7G")) + out <- plot_tRNA_structure( + "tRNA-Phe-GAA", + "Escherichia coli", + modifications = mods, + layout = "elbow" + ) + doc <- xml2::read_xml(out) + circles <- xml2::xml_find_all(doc, ".//*[local-name()='circle']") + expect_gte(length(circles), 2) +}) From 6a6b050423add2c2da6842084d4163b2be45c0fd Mon Sep 17 00:00:00 2001 From: Jay Hesselberth Date: Sun, 10 May 2026 10:17:23 -0600 Subject: [PATCH 2/3] Make D-arm vertical to match canonical L-shape MIME-Version: 1.0 Content-Type: text/plain; charset=UTF-8 Content-Transfer-Encoding: 8bit Initial elbow layout drew the D-arm horizontally with D-loop at the far left. The reference figure (Matsumoto 2026 JBC fig 2A) shows the L-shape with D-arm and AC-arm both VERTICAL — sitting side-by-side as parallel helices below the horizontal acceptor+T stack: * D-arm on the LEFT, 4 bp going DOWN, D-loop curling at bottom-left * AC-arm on the RIGHT, 5 bp going DOWN, AC-loop at the bottom * pos 26 hinge bridges D-arm top-right to AC-arm top-left * variable region curves from AC-arm top-right up to T-stem 5' Updates the geometry constants and the D-arm + D-loop placement code in generate_elbow.py and regenerates all 29 bundled E. coli elbow SVG/JSON pairs. Visual check on Phe, Asp, and Val now matches the reference. Co-Authored-By: Claude Opus 4.7 (1M context) --- data-raw/structures/generate_elbow.py | 106 ++++---- .../Escherichia_coli/elbow/tRNA-Ala-GGC.json | 238 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Ala-GGC.svg | 184 ++++++------- .../Escherichia_coli/elbow/tRNA-Ala-TGC.json | 238 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Ala-TGC.svg | 184 ++++++------- .../Escherichia_coli/elbow/tRNA-Arg-ACG.json | 242 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Arg-ACG.svg | 188 +++++++------- .../Escherichia_coli/elbow/tRNA-Arg-CCG.json | 242 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Arg-CCG.svg | 188 +++++++------- .../Escherichia_coli/elbow/tRNA-Arg-CCT.json | 234 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Arg-CCT.svg | 180 ++++++------- .../Escherichia_coli/elbow/tRNA-Arg-TCT.json | 242 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Arg-TCT.svg | 188 +++++++------- .../Escherichia_coli/elbow/tRNA-Asn-GTT.json | 238 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Asn-GTT.svg | 184 ++++++------- .../Escherichia_coli/elbow/tRNA-Asp-GTC.json | 242 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Asp-GTC.svg | 188 +++++++------- .../Escherichia_coli/elbow/tRNA-Cys-GCA.json | 230 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Cys-GCA.svg | 176 ++++++------- .../Escherichia_coli/elbow/tRNA-Gln-CTG.json | 234 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Gln-CTG.svg | 180 ++++++------- .../Escherichia_coli/elbow/tRNA-Gln-TTG.json | 234 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Gln-TTG.svg | 180 ++++++------- .../Escherichia_coli/elbow/tRNA-Glu-TTC.json | 238 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Glu-TTC.svg | 184 ++++++------- .../Escherichia_coli/elbow/tRNA-Gly-CCC.json | 230 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Gly-CCC.svg | 176 ++++++------- .../Escherichia_coli/elbow/tRNA-Gly-GCC.json | 238 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Gly-GCC.svg | 184 ++++++------- .../Escherichia_coli/elbow/tRNA-Gly-TCC.json | 234 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Gly-TCC.svg | 180 ++++++------- .../Escherichia_coli/elbow/tRNA-His-GTG.json | 238 ++++++++--------- .../Escherichia_coli/elbow/tRNA-His-GTG.svg | 184 ++++++------- .../Escherichia_coli/elbow/tRNA-Ile-GAT.json | 242 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Ile-GAT.svg | 188 +++++++------- .../Escherichia_coli/elbow/tRNA-Lys-TTT.json | 238 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Lys-TTT.svg | 184 ++++++------- .../Escherichia_coli/elbow/tRNA-Met-CAT.json | 242 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Met-CAT.svg | 188 +++++++------- .../Escherichia_coli/elbow/tRNA-Phe-GAA.json | 238 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Phe-GAA.svg | 184 ++++++------- .../Escherichia_coli/elbow/tRNA-Pro-CGG.json | 242 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Pro-CGG.svg | 188 +++++++------- .../Escherichia_coli/elbow/tRNA-Pro-GGG.json | 242 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Pro-GGG.svg | 188 +++++++------- .../Escherichia_coli/elbow/tRNA-Pro-TGG.json | 242 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Pro-TGG.svg | 188 +++++++------- .../Escherichia_coli/elbow/tRNA-Thr-CGT.json | 238 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Thr-CGT.svg | 184 ++++++------- .../Escherichia_coli/elbow/tRNA-Thr-GGT.json | 238 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Thr-GGT.svg | 184 ++++++------- .../Escherichia_coli/elbow/tRNA-Thr-TGT.json | 238 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Thr-TGT.svg | 184 ++++++------- .../Escherichia_coli/elbow/tRNA-Trp-CCA.json | 238 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Trp-CCA.svg | 184 ++++++------- .../Escherichia_coli/elbow/tRNA-Val-GAC.json | 242 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Val-GAC.svg | 188 +++++++------- .../Escherichia_coli/elbow/tRNA-Val-TAC.json | 238 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Val-TAC.svg | 184 ++++++------- 59 files changed, 6184 insertions(+), 6176 deletions(-) diff --git a/data-raw/structures/generate_elbow.py b/data-raw/structures/generate_elbow.py index 8911f05..c88090c 100644 --- a/data-raw/structures/generate_elbow.py +++ b/data-raw/structures/generate_elbow.py @@ -57,18 +57,20 @@ # T-loop (54..60) curls at far LEFT of the combined helix T_LOOP_RADIUS = 13.0 -# D-arm: horizontal, BELOW the top stack, extending LEFT from below pos 7. -# Its junction-side end (pos 10/25) sits directly under pos 7 (acceptor 5' end). -D_TOP_Y = BOT_Y + 18.0 # top row of D-stem -D_BOT_Y = D_TOP_Y + P # bottom row of D-stem -D_LOOP_RADIUS = 12.0 - -# AC-arm: vertical, BELOW the elbow, going DOWN. AC-stem column placed under -# the elbow region (between T-stem and acceptor) so the variable region's -# path from pos 43 up to pos 49 is short and roughly vertical. -AC_X_LEFT = 132.0 -AC_X_RIGHT = AC_X_LEFT + P # column for AC-stem 3' (39..43) -AC_TOP_Y = D_BOT_Y + 22.0 # y of pos 27 (top of AC-stem 5') +# Both D-arm and AC-arm hang DOWN as parallel vertical helices below the top +# stack — D-arm to the LEFT (smaller, 4 bp + D-loop at the bottom-left), +# AC-arm to the RIGHT (larger, 5 bp + AC-loop at the bottom). Together with +# the horizontal acceptor+T helix at the top this gives the canonical L-shape +# elbow projection seen in textbook tRNA depictions (e.g., Matsumoto 2026 +# JBC fig 2A). +D_X_LEFT = 110.0 # left column of D-stem (pos 10-13) +D_X_RIGHT = D_X_LEFT + P +D_TOP_Y = BOT_Y + 22.0 +D_LOOP_RADIUS = 11.5 + +AC_X_LEFT = 138.0 +AC_X_RIGHT = AC_X_LEFT + P +AC_TOP_Y = D_TOP_Y # AC-arm aligned vertically with D-arm AC_LOOP_RADIUS = 13.0 # --- variable-arm detection -------------------------------------------- @@ -307,73 +309,79 @@ def elbow_coord_table() -> dict[str, tuple[float, float]]: # 73 just above 72 on the same column, 74-76 stacking up coords[str(n)] = (cca_x, TOP_Y - (k + 1) * S) - # ----- D-arm: horizontal stem, D-loop curls LEFT ----- - # D-arm shifted LEFT of pos 7 so the variable-region curve from AC-stem 3' - # up to pos 49 does not collide with the D-stem on the right end. - # Hinge 8, 9 carry the backbone diagonally LEFT-and-DOWN from pos 7 to - # pos 10 (the junction-side end of D-stem 5'). - d_anchor_x = acc_left_x - 2 * S # x of pos 10 + # ----- D-arm: VERTICAL stem, D-loop curls at BOTTOM-LEFT ----- + # pos 10 (D-stem 5' first) at TOP-LEFT — paired with pos 25 at TOP-RIGHT. + # Stem extends DOWN from there; pos 13 at BOTTOM-LEFT, pos 22 at BOTTOM- + # RIGHT. D-loop (14..21) is a 180° arc connecting pos 13 (bottom-left) + # around the LEFT side back up to pos 22 (bottom-right) — i.e., it + # bulges LEFT and DOWN from the bottom of the stem, matching the + # canonical L-shape projection. + # Hinges 8, 9 are the diagonal connector from pos 7 (top stack, bot row, + # at acc_left_x) DOWN-LEFT to pos 10 (top-left of D-arm). coords["8"] = ( - acc_left_x - 0.4 * S, + acc_left_x - (acc_left_x - D_X_LEFT) * 0.35, BOT_Y + (D_TOP_Y - BOT_Y) * 0.4, ) coords["9"] = ( - acc_left_x - 1.3 * S, + acc_left_x - (acc_left_x - D_X_LEFT) * 0.7, BOT_Y + (D_TOP_Y - BOT_Y) * 0.8, ) + # D-stem 5' (10..13) on LEFT column, top-to-bottom for n in range(10, 14): - x = d_anchor_x - (n - 10) * S - coords[str(n)] = (x, D_TOP_Y) + coords[str(n)] = (D_X_LEFT, D_TOP_Y + (n - 10) * S) + # D-stem 3' (22..25) on RIGHT column; pair: 25-10, 24-11, 23-12, 22-13 for n in range(22, 26): - # pair: 22-13, 23-12, 24-11, 25-10 - # so pos 25 at d_anchor_x (paired with 10), pos 22 at d_anchor_x - 3*S (paired with 13) - x = d_anchor_x - (25 - n) * S - coords[str(n)] = (x, D_BOT_Y) - - d_loop_left_x = d_anchor_x - 3 * S # x of pos 13 / pos 22 - - # ----- D-loop (14..21), 8 residues on 180° arc curling LEFT ----- - # Some tRNAs include 17a, 20a, 20b insertions; we'll handle those by - # adding labels at interpolated positions below. - arc_cx_d = d_loop_left_x - D_LOOP_RADIUS * 0.35 - arc_cy_d = (D_TOP_Y + D_BOT_Y) / 2 + coords[str(n)] = (D_X_RIGHT, D_TOP_Y + (25 - n) * S) + + d_bot_y = D_TOP_Y + 3 * S # y of pos 13 / pos 22 + + # ----- D-loop (14..21), 8 residues on a 180° arc curling LEFT-and-DOWN ----- + # Arc center sits a bit DOWN-LEFT of the stem bottom. Sweep angle covers + # the LEFT half of the circle, from "just past pos 13" (top of arc, bot + # of stem on left col) curving DOWN through far-LEFT and back UP to + # "just before pos 22" (top of arc, bot of stem on right col). + arc_cx_d = D_X_LEFT + P / 2 + arc_cy_d = d_bot_y + D_LOOP_RADIUS * 0.55 for k, n in enumerate(range(14, 22)): t = (k + 0.5) / 8 - theta = math.pi / 2 + t * math.pi + # Parameterize: angle from pi (left of stem-left-column-bottom) + # sweeping CCW through 3pi/2 (BOTTOM of arc) to 2pi (right side). + # In SVG y-down, y = cy + r*sin(theta) — sin pi to 2pi gives 0 to 0 + # via -1 at 3pi/2; we want POSITIVE y at the bottom of the arc, so + # use abs offset. + theta = math.pi + t * math.pi x = arc_cx_d + D_LOOP_RADIUS * math.cos(theta) - y = arc_cy_d + D_LOOP_RADIUS * math.sin(theta) + y = arc_cy_d - D_LOOP_RADIUS * math.sin(theta) coords[str(n)] = (x, y) # D-loop insertions: 17a is between 17 and 18; 20a between 20 and 21; # 20b between 20a and 21. Place them on the same arc with offset t. - # (Sprinzl insertion convention: 17a immediately follows 17 in sequence.) - # We compute approximate t-values to keep the loop visually balanced. insertion_ts = { - "17a": (3.5 + 0.5) / 8, # between 17 (k=3) and 18 (k=4) - "20a": (6.3 + 0.5) / 8, # between 20 (k=6) and 21 (k=7) + "17a": (3.5 + 0.5) / 8, + "20a": (6.3 + 0.5) / 8, "20b": (6.6 + 0.5) / 8, } for label, t in insertion_ts.items(): - theta = math.pi / 2 + t * math.pi + theta = math.pi + t * math.pi x = arc_cx_d + D_LOOP_RADIUS * math.cos(theta) - y = arc_cy_d + D_LOOP_RADIUS * math.sin(theta) + y = arc_cy_d - D_LOOP_RADIUS * math.sin(theta) coords[label] = (x, y) - # ----- pos 26 (hinge between D-stem 3' and AC-stem 5') ----- - # diagonal from pos 25 (d_anchor_x, D_BOT_Y) to pos 27 (AC_X_LEFT, AC_TOP_Y). + # ----- pos 26 (hinge between D-stem 3' top and AC-stem 5' top) ----- + # short horizontal bridge from D-arm TOP-RIGHT (pos 25) over to AC-arm + # TOP-LEFT (pos 27). Both at the same y as the top of the side arms. coords["26"] = ( - d_anchor_x - (d_anchor_x - AC_X_LEFT) * 0.55, - D_BOT_Y + (AC_TOP_Y - D_BOT_Y) * 0.55, + (D_X_RIGHT + AC_X_LEFT) / 2, + D_TOP_Y - 2.5, ) # ----- anticodon stem (27..31 left col, 39..43 right col) ----- - # Pairs: 27-43, 28-42, 29-41, 30-40, 31-39 - # 27 at top-left of AC-arm, 31 at bottom-left (just above AC-loop). + # VERTICAL helix to the RIGHT of the D-arm. Pairs: 27-43, 28-42, ..., 31-39 + # 27 at top-left, 31 at bottom-left (just above AC-loop). for n in range(27, 32): y = AC_TOP_Y + (n - 27) * S coords[str(n)] = (AC_X_LEFT, y) for n in range(39, 44): - # 43 at top-right (paired with 27); 39 at bottom-right (paired with 31) y = AC_TOP_Y + (43 - n) * S coords[str(n)] = (AC_X_RIGHT, y) diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.json index 0eb55e2..c61efd8 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.json @@ -44,248 +44,248 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "C", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "U", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 18 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 19 }, { "base": "G", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 20 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 21 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 22 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 23 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 24 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 25 }, { "base": "G", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 26 }, { "base": "C", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 27 }, { "base": "U", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 28 }, { "base": "U", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 29 }, { "base": "G", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 30 }, { "base": "C", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 31 }, { "base": "A", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 32 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 33 }, { "base": "G", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 34 }, { "base": "G", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 35 }, { "base": "C", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 36 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 37 }, { "base": "U", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 38 }, { "base": "G", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 39 }, { "base": "C", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 40 }, { "base": "A", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 41 }, { "base": "A", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 42 }, { "base": "G", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 43 }, { "base": "A", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 44 }, { "base": "G", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 45 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 46 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 47 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 48 }, { @@ -458,7 +458,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -503,58 +503,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.svg index 0ea9bf4..eb7b211 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Ala-GGC @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,128 +51,128 @@ A - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - C + + C - - U + + U - - G + + G - - G + + G - - G + + G - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - U + + U - - U + + U - - G + + G - - C + + C - - A + + A - - U + + U - - G + + G - - G + + G - - C + + C - - A + + A - - U + + U - - G + + G - - C + + C - - A + + A - - A + + A - - G + + G - - A + + A - - G + + G - - G + + G - - U + + U - - C + + C A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.json index a2457be..cddfc49 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.json @@ -44,248 +44,248 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "C", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "U", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 18 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 19 }, { "base": "G", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 20 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 21 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 22 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 23 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 24 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 25 }, { "base": "G", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 26 }, { "base": "C", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 27 }, { "base": "C", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 28 }, { "base": "U", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 29 }, { "base": "G", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 30 }, { "base": "C", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 31 }, { "base": "U", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 32 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 33 }, { "base": "U", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 34 }, { "base": "G", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 35 }, { "base": "C", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 36 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 37 }, { "base": "C", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 38 }, { "base": "G", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 39 }, { "base": "C", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 40 }, { "base": "A", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 41 }, { "base": "G", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 42 }, { "base": "G", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 43 }, { "base": "A", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 44 }, { "base": "G", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 45 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 46 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 47 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 48 }, { @@ -458,7 +458,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -503,58 +503,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.svg index 7e391b1..866f449 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Ala-TGC @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,128 +51,128 @@ A - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - C + + C - - U + + U - - G + + G - - G + + G - - G + + G - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - C + + C - - U + + U - - G + + G - - C + + C - - U + + U - - U + + U - - U + + U - - G + + G - - C + + C - - A + + A - - C + + C - - G + + G - - C + + C - - A + + A - - G + + G - - G + + G - - A + + A - - G + + G - - G + + G - - U + + U - - C + + C U diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.json index d9ca253..dee9324 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.json @@ -44,254 +44,254 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "C", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "U", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 18 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 19 }, { "base": "A", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 20 }, { "base": "U", - "x": 102.19, - "y": 53.65, + "x": 124.03, + "y": 98.79, "pos": 21 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 22 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 23 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 24 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 25 }, { "base": "U", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 26 }, { "base": "A", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 27 }, { "base": "C", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 28 }, { "base": "U", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 29 }, { "base": "C", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 30 }, { "base": "G", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 31 }, { "base": "G", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 32 }, { "base": "C", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 33 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 34 }, { "base": "A", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 35 }, { "base": "C", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 36 }, { "base": "G", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 37 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 38 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 39 }, { "base": "C", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 40 }, { "base": "C", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 41 }, { "base": "G", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 42 }, { "base": "A", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 43 }, { "base": "G", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 44 }, { "base": "C", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 45 }, { "base": "G", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 46 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 47 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 48 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 49 }, { @@ -464,7 +464,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -509,58 +509,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.svg index b995f79..ae0973d 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Arg-ACG @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,131 +51,131 @@ G - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - C + + C - - U + + U - - G + + G - - G + + G - - A + + A - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - U + + U - - A + + A - - C + + C - - U + + U - - C + + C - - G + + G - - G + + G - - C + + C - - U + + U - - A + + A - - C + + C - - G + + G - - A + + A - - A + + A - - C + + C - - C + + C - - G + + G - - A + + A - - G + + G - - C + + C - - G + + G - - G + + G - - U + + U - - C + + C G diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.json index 301981a..42c8626 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.json @@ -44,254 +44,254 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "C", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "U", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 18 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 19 }, { "base": "A", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 20 }, { "base": "U", - "x": 102.19, - "y": 53.65, + "x": 124.03, + "y": 98.79, "pos": 21 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 22 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 23 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 24 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 25 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 26 }, { "base": "G", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 27 }, { "base": "C", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 28 }, { "base": "U", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 29 }, { "base": "G", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 30 }, { "base": "C", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 31 }, { "base": "C", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 32 }, { "base": "C", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 33 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 34 }, { "base": "C", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 35 }, { "base": "C", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 36 }, { "base": "G", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 37 }, { "base": "G", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 38 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 39 }, { "base": "G", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 40 }, { "base": "G", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 41 }, { "base": "C", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 42 }, { "base": "A", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 43 }, { "base": "G", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 44 }, { "base": "A", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 45 }, { "base": "G", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 46 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 47 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 48 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 49 }, { @@ -464,7 +464,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -509,58 +509,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.svg index 5e52209..5248a3f 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Arg-CCG @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,131 +51,131 @@ G - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - C + + C - - U + + U - - G + + G - - G + + G - - A + + A - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - U + + U - - G + + G - - C + + C - - C + + C - - C + + C - - U + + U - - C + + C - - C + + C - - G + + G - - G + + G - - A + + A - - G + + G - - G + + G - - C + + C - - A + + A - - G + + G - - A + + A - - G + + G - - G + + G - - U + + U - - C + + C U diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.json index 4e44498..9fdff5b 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.json @@ -44,242 +44,242 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "U", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "A", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "A", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "U", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 18 }, { "base": "A", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 19 }, { "base": "U", - "x": 102.19, - "y": 53.65, + "x": 124.03, + "y": 98.79, "pos": 20 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 21 }, { "base": "U", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 22 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 23 }, { "base": "A", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 24 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 25 }, { "base": "G", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 26 }, { "base": "A", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 27 }, { "base": "G", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 28 }, { "base": "C", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 29 }, { "base": "C", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 30 }, { "base": "C", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 31 }, { "base": "C", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 32 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 33 }, { "base": "C", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 34 }, { "base": "C", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 35 }, { "base": "U", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 36 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 37 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 38 }, { "base": "G", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 39 }, { "base": "G", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 40 }, { "base": "G", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 41 }, { "base": "C", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 42 }, { "base": "U", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 43 }, { "base": "A", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 44 }, { "base": "A", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 45 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 46 }, { "base": "U", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 47 }, { @@ -452,7 +452,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -497,58 +497,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.svg index ea38c23..3657b64 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Arg-CCT @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,125 +51,125 @@ U - - U + + U - - A + + A - - G + + G - - U + + U - - U + + U - - A + + A - - A + + A - - A + + A - - U + + U - - G + + G - - G + + G - - A + + A - - U + + U - - A + + A - - U + + U - - A + + A - - A + + A - - C + + C - - G + + G - - A + + A - - G + + G - - C + + C - - C + + C - - C + + C - - C + + C - - U + + U - - C + + C - - C + + C - - U + + U - - A + + A - - A + + A - - G + + G - - G + + G - - G + + G - - C + + C - - U + + U - - A + + A - - A + + A - - U + + U - - U + + U G diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.json index 75d60b7..dec1aaf 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.json @@ -44,254 +44,254 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "U", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "U", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 18 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 19 }, { "base": "A", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 20 }, { "base": "U", - "x": 102.19, - "y": 53.65, + "x": 124.03, + "y": 98.79, "pos": 21 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 22 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 23 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 24 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 25 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 26 }, { "base": "A", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 27 }, { "base": "A", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 28 }, { "base": "C", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 29 }, { "base": "G", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 30 }, { "base": "A", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 31 }, { "base": "C", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 32 }, { "base": "C", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 33 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 34 }, { "base": "U", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 35 }, { "base": "C", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 36 }, { "base": "U", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 37 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 38 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 39 }, { "base": "G", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 40 }, { "base": "U", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 41 }, { "base": "C", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 42 }, { "base": "G", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 43 }, { "base": "U", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 44 }, { "base": "G", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 45 }, { "base": "G", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 46 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 47 }, { "base": "C", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 48 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 49 }, { @@ -464,7 +464,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -509,58 +509,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.svg index 0a49ee7..bad15ec 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Arg-TCT @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,131 +51,131 @@ U - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - G + + G - - A + + A - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - A + + A - - C + + C - - G + + G - - A + + A - - C + + C - - C + + C - - U + + U - - U + + U - - C + + C - - U + + U - - A + + A - - A + + A - - G + + G - - U + + U - - C + + C - - G + + G - - U + + U - - G + + G - - G + + G - - G + + G - - C + + C - - C + + C G diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.json index de9205a..fb8363b 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.json @@ -44,248 +44,248 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "U", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "U", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "C", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 18 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 19 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 20 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 21 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 22 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 23 }, { "base": "A", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 24 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 25 }, { "base": "G", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 26 }, { "base": "G", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 27 }, { "base": "C", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 28 }, { "base": "G", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 29 }, { "base": "G", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 30 }, { "base": "A", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 31 }, { "base": "C", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 32 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 33 }, { "base": "G", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 34 }, { "base": "U", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 35 }, { "base": "U", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 36 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 37 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 38 }, { "base": "U", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 39 }, { "base": "C", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 40 }, { "base": "C", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 41 }, { "base": "G", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 42 }, { "base": "U", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 43 }, { "base": "A", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 44 }, { "base": "U", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 45 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 46 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 47 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 48 }, { @@ -458,7 +458,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -503,58 +503,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.svg index 29a5c80..91bb782 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Asn-GTT @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,128 +51,128 @@ G - - U + + U - - A + + A - - G + + G - - U + + U - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - A + + A - - C + + C - - G + + G - - G + + G - - C + + C - - G + + G - - G + + G - - A + + A - - C + + C - - U + + U - - G + + G - - U + + U - - U + + U - - A + + A - - A + + A - - U + + U - - C + + C - - C + + C - - G + + G - - U + + U - - A + + A - - U + + U - - G + + G - - U + + U - - C + + C A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.json index 4382eb1..539a449 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.json @@ -44,254 +44,254 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "U", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "U", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "C", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 18 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 19 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 20 }, { "base": "U", - "x": 102.19, - "y": 53.65, + "x": 124.03, + "y": 98.79, "pos": 21 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 22 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 23 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 24 }, { "base": "A", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 25 }, { "base": "U", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 26 }, { "base": "A", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 27 }, { "base": "C", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 28 }, { "base": "C", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 29 }, { "base": "U", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 30 }, { "base": "G", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 31 }, { "base": "C", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 32 }, { "base": "C", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 33 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 34 }, { "base": "G", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 35 }, { "base": "U", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 36 }, { "base": "C", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 37 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 38 }, { "base": "C", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 39 }, { "base": "G", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 40 }, { "base": "C", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 41 }, { "base": "A", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 42 }, { "base": "G", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 43 }, { "base": "G", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 44 }, { "base": "G", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 45 }, { "base": "G", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 46 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 47 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 48 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 49 }, { @@ -464,7 +464,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -509,58 +509,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.svg index 08abe01..9690d57 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Asp-GTC @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,131 +51,131 @@ G - - U + + U - - A + + A - - G + + G - - U + + U - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - U + + U - - U + + U - - A + + A - - G + + G - - A + + A - - A + + A - - U + + U - - A + + A - - C + + C - - C + + C - - U + + U - - G + + G - - C + + C - - C + + C - - U + + U - - G + + G - - U + + U - - C + + C - - A + + A - - C + + C - - G + + G - - C + + C - - A + + A - - G + + G - - G + + G - - G + + G - - G + + G - - G + + G - - U + + U - - C + + C G diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.json index 6c3c65c..98e730a 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.json @@ -44,236 +44,236 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "A", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "A", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "A", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "C", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 18 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 19 }, { "base": "U", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 20 }, { "base": "A", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 21 }, { "base": "U", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 22 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 23 }, { "base": "U", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 24 }, { "base": "A", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 25 }, { "base": "G", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 26 }, { "base": "C", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 27 }, { "base": "G", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 28 }, { "base": "G", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 29 }, { "base": "A", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 30 }, { "base": "U", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 31 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 32 }, { "base": "G", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 33 }, { "base": "C", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 34 }, { "base": "A", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 35 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 36 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 37 }, { "base": "U", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 38 }, { "base": "C", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 39 }, { "base": "C", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 40 }, { "base": "G", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 41 }, { "base": "U", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 42 }, { "base": "C", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 43 }, { "base": "U", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 44 }, { "base": "A", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 45 }, { "base": "G", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 46 }, { @@ -446,7 +446,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -491,58 +491,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.svg index 4345635..0e2071f 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Cys-GCA @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,122 +51,122 @@ U - - U + + U - - A + + A - - A + + A - - C + + C - - A + + A - - A + + A - - A + + A - - G + + G - - C + + C - - G + + G - - G + + G - - U + + U - - U + + U - - A + + A - - U + + U - - G + + G - - U + + U - - A + + A - - G + + G - - C + + C - - G + + G - - G + + G - - A + + A - - U + + U - - U + + U - - G + + G - - C + + C - - A + + A - - A + + A - - A + + A - - U + + U - - C + + C - - C + + C - - G + + G - - U + + U - - C + + C - - U + + U - - A + + A - - G + + G U diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.json index 36f9aca..cdc4d37 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.json @@ -44,242 +44,242 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "C", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "C", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "A", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "C", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 18 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 19 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 20 }, { "base": "A", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 21 }, { "base": "G", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 22 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 23 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 24 }, { "base": "A", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 25 }, { "base": "C", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 26 }, { "base": "C", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 27 }, { "base": "G", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 28 }, { "base": "G", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 29 }, { "base": "A", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 30 }, { "base": "U", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 31 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 32 }, { "base": "C", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 33 }, { "base": "U", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 34 }, { "base": "G", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 35 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 36 }, { "base": "U", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 37 }, { "base": "U", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 38 }, { "base": "C", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 39 }, { "base": "C", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 40 }, { "base": "G", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 41 }, { "base": "G", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 42 }, { "base": "C", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 43 }, { "base": "A", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 44 }, { "base": "U", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 45 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 46 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 47 }, { @@ -452,7 +452,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -497,58 +497,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.svg index 3ff5f87..7c1f305 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Gln-CTG @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,125 +51,125 @@ A - - U + + U - - C + + C - - G + + G - - C + + C - - C + + C - - A + + A - - A + + A - - G + + G - - C + + C - - G + + G - - G + + G - - U + + U - - A + + A - - A + + A - - G + + G - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - G + + G - - G + + G - - A + + A - - U + + U - - U + + U - - C + + C - - U + + U - - G + + G - - A + + A - - U + + U - - U + + U - - C + + C - - C + + C - - G + + G - - G + + G - - C + + C - - A + + A - - U + + U - - U + + U - - C + + C C diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.json index 2256c2c..e31a2ae 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.json @@ -44,242 +44,242 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "C", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "C", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "A", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "C", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 18 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 19 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 20 }, { "base": "A", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 21 }, { "base": "G", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 22 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 23 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 24 }, { "base": "A", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 25 }, { "base": "C", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 26 }, { "base": "C", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 27 }, { "base": "G", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 28 }, { "base": "G", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 29 }, { "base": "U", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 30 }, { "base": "U", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 31 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 32 }, { "base": "U", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 33 }, { "base": "U", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 34 }, { "base": "G", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 35 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 36 }, { "base": "U", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 37 }, { "base": "A", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 38 }, { "base": "C", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 39 }, { "base": "C", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 40 }, { "base": "G", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 41 }, { "base": "G", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 42 }, { "base": "C", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 43 }, { "base": "A", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 44 }, { "base": "U", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 45 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 46 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 47 }, { @@ -452,7 +452,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -497,58 +497,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.svg index 388d463..0db24ee 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Gln-TTG @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,125 +51,125 @@ A - - U + + U - - C + + C - - G + + G - - C + + C - - C + + C - - A + + A - - A + + A - - G + + G - - C + + C - - G + + G - - G + + G - - U + + U - - A + + A - - A + + A - - G + + G - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - G + + G - - G + + G - - U + + U - - U + + U - - U + + U - - U + + U - - U + + U - - G + + G - - A + + A - - U + + U - - A + + A - - C + + C - - C + + C - - G + + G - - G + + G - - C + + C - - A + + A - - U + + U - - U + + U - - C + + C C diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.json index cc0ef9e..f408d37 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.json @@ -44,248 +44,248 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "C", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "U", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "C", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "U", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "A", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 18 }, { "base": "C", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 19 }, { "base": "C", - "x": 102.19, - "y": 53.65, + "x": 124.03, + "y": 98.79, "pos": 20 }, { "base": "C", - "x": 103.49, - "y": 53.08, + "x": 124.57, + "y": 97.55, "pos": 21 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 22 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 23 }, { "base": "G", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 24 }, { "base": "A", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 25 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 26 }, { "base": "A", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 27 }, { "base": "C", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 28 }, { "base": "C", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 29 }, { "base": "G", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 30 }, { "base": "C", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 31 }, { "base": "C", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 32 }, { "base": "C", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 33 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 34 }, { "base": "U", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 35 }, { "base": "U", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 36 }, { "base": "C", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 37 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 38 }, { "base": "C", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 39 }, { "base": "G", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 40 }, { "base": "G", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 41 }, { "base": "C", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 42 }, { "base": "G", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 43 }, { "base": "G", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 44 }, { "base": "U", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 45 }, { "base": "A", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 46 }, { "base": "A", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 47 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 48 }, { @@ -458,7 +458,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -503,58 +503,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.svg index 2d39c5f..e829a61 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Glu-TTC @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,128 +51,128 @@ U - - U + + U - - C + + C - - G + + G - - U + + U - - C + + C - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - G + + G - - C + + C - - C + + C - - C + + C - - A + + A - - G + + G - - G + + G - - A + + A - - C + + C - - A + + A - - C + + C - - C + + C - - G + + G - - C + + C - - C + + C - - C + + C - - U + + U - - U + + U - - U + + U - - C + + C - - A + + A - - C + + C - - G + + G - - G + + G - - C + + C - - G + + G - - G + + G - - U + + U - - A + + A - - A + + A - - C + + C A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.json index 23a14d0..447a515 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.json @@ -44,236 +44,236 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "U", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "A", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "U", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 18 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 19 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 20 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 21 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 22 }, { "base": "A", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 23 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 24 }, { "base": "G", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 25 }, { "base": "A", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 26 }, { "base": "G", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 27 }, { "base": "A", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 28 }, { "base": "G", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 29 }, { "base": "C", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 30 }, { "base": "U", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 31 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 32 }, { "base": "C", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 33 }, { "base": "C", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 34 }, { "base": "C", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 35 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 36 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 37 }, { "base": "G", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 38 }, { "base": "C", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 39 }, { "base": "U", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 40 }, { "base": "C", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 41 }, { "base": "U", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 42 }, { "base": "A", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 43 }, { "base": "U", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 44 }, { "base": "A", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 45 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 46 }, { @@ -446,7 +446,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -491,58 +491,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.svg index 6e03b40..6749d7f 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Gly-CCC @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,122 +51,122 @@ G - - U + + U - - A + + A - - G + + G - - U + + U - - U + + U - - C + + C - - A + + A - - A + + A - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - A + + A - - C + + C - - G + + G - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - U + + U - - U + + U - - C + + C - - C + + C - - C + + C - - A + + A - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - U + + U - - A + + A - - U + + U - - A + + A - - C + + C G diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.json index 34c8cb5..fa7a35b 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.json @@ -44,248 +44,248 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "U", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "U", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 18 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 19 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 20 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 21 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 22 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 23 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 24 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 25 }, { "base": "A", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 26 }, { "base": "C", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 27 }, { "base": "G", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 28 }, { "base": "A", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 29 }, { "base": "C", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 30 }, { "base": "C", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 31 }, { "base": "U", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 32 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 33 }, { "base": "G", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 34 }, { "base": "C", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 35 }, { "base": "C", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 36 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 37 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 38 }, { "base": "G", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 39 }, { "base": "G", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 40 }, { "base": "U", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 41 }, { "base": "C", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 42 }, { "base": "G", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 43 }, { "base": "G", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 44 }, { "base": "G", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 45 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 46 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 47 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 48 }, { @@ -458,7 +458,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -503,58 +503,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.svg index 3ef2f53..f0cb786 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Gly-GCC @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,128 +51,128 @@ A - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - C + + C - - G + + G - - A + + A - - C + + C - - C + + C - - U + + U - - U + + U - - G + + G - - C + + C - - C + + C - - A + + A - - A + + A - - G + + G - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - G + + G - - G + + G - - U + + U - - C + + C G diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.json index cc633c5..28f10c1 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.json @@ -44,242 +44,242 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "C", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "U", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "A", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "U", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "A", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "U", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 18 }, { "base": "C", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 19 }, { "base": "U", - "x": 102.19, - "y": 53.65, + "x": 124.03, + "y": 98.79, "pos": 20 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 21 }, { "base": "U", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 22 }, { "base": "U", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 23 }, { "base": "A", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 24 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 25 }, { "base": "C", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 26 }, { "base": "U", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 27 }, { "base": "C", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 28 }, { "base": "A", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 29 }, { "base": "G", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 30 }, { "base": "C", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 31 }, { "base": "C", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 32 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 33 }, { "base": "U", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 34 }, { "base": "C", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 35 }, { "base": "C", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 36 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 37 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 38 }, { "base": "G", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 39 }, { "base": "C", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 40 }, { "base": "U", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 41 }, { "base": "G", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 42 }, { "base": "A", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 43 }, { "base": "U", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 44 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 45 }, { "base": "A", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 46 }, { "base": "U", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 47 }, { @@ -452,7 +452,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -497,58 +497,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.svg index ba1daee..e9ef97a 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Gly-TCC @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,125 +51,125 @@ A - - U + + U - - C + + C - - G + + G - - U + + U - - A + + A - - U + + U - - A + + A - - A + + A - - U + + U - - G + + G - - G + + G - - C + + C - - U + + U - - A + + A - - U + + U - - U + + U - - A + + A - - C + + C - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - C + + C - - C + + C - - U + + U - - U + + U - - C + + C - - C + + C - - A + + A - - A + + A - - G + + G - - C + + C - - U + + U - - G + + G - - A + + A - - U + + U - - G + + G - - A + + A - - U + + U G diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.json index 3ccb1f0..9506efb 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.json @@ -44,248 +44,248 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "U", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "U", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 18 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 19 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 20 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 21 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 22 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 23 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 24 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 25 }, { "base": "C", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 26 }, { "base": "C", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 27 }, { "base": "U", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 28 }, { "base": "G", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 29 }, { "base": "G", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 30 }, { "base": "A", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 31 }, { "base": "U", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 32 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 33 }, { "base": "G", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 34 }, { "base": "U", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 35 }, { "base": "G", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 36 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 37 }, { "base": "U", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 38 }, { "base": "U", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 39 }, { "base": "C", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 40 }, { "base": "C", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 41 }, { "base": "A", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 42 }, { "base": "G", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 43 }, { "base": "U", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 44 }, { "base": "U", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 45 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 46 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 47 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 48 }, { @@ -458,7 +458,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -503,58 +503,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.svg index 02036ff..a47eb36 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-His-GTG @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,128 +51,128 @@ A - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - C + + C - - C + + C - - U + + U - - G + + G - - G + + G - - A + + A - - U + + U - - U + + U - - G + + G - - U + + U - - G + + G - - A + + A - - U + + U - - U + + U - - C + + C - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - U + + U - - C + + C G diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.json index 3ceaef2..a79fd1a 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.json @@ -44,254 +44,254 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "G", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "U", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 18 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 19 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 20 }, { "base": "U", - "x": 102.19, - "y": 53.65, + "x": 124.03, + "y": 98.79, "pos": 21 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 22 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 23 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 24 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 25 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 26 }, { "base": "G", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 27 }, { "base": "C", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 28 }, { "base": "A", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 29 }, { "base": "C", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 30 }, { "base": "C", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 31 }, { "base": "C", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 32 }, { "base": "C", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 33 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 34 }, { "base": "G", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 35 }, { "base": "A", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 36 }, { "base": "U", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 37 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 38 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 39 }, { "base": "G", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 40 }, { "base": "G", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 41 }, { "base": "G", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 42 }, { "base": "U", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 43 }, { "base": "G", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 44 }, { "base": "A", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 45 }, { "base": "G", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 46 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 47 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 48 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 49 }, { @@ -464,7 +464,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -509,58 +509,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.svg index 1d1d2d1..bbf2e28 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Ile-GAT @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,131 +51,131 @@ G - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - G + + G - - U + + U - - G + + G - - G + + G - - U + + U - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - C + + C - - C + + C - - U + + U - - G + + G - - A + + A - - U + + U - - A + + A - - A + + A - - G + + G - - G + + G - - G + + G - - U + + U - - G + + G - - A + + A - - G + + G - - G + + G - - U + + U - - C + + C G diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.json index 864e10c..f843769 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.json @@ -44,248 +44,248 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "U", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "U", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 18 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 19 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 20 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 21 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 22 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 23 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 24 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 25 }, { "base": "A", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 26 }, { "base": "G", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 27 }, { "base": "U", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 28 }, { "base": "U", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 29 }, { "base": "G", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 30 }, { "base": "A", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 31 }, { "base": "C", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 32 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 33 }, { "base": "U", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 34 }, { "base": "U", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 35 }, { "base": "U", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 36 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 37 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 38 }, { "base": "U", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 39 }, { "base": "C", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 40 }, { "base": "A", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 41 }, { "base": "A", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 42 }, { "base": "U", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 43 }, { "base": "U", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 44 }, { "base": "G", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 45 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 46 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 47 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 48 }, { @@ -458,7 +458,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -503,58 +503,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.svg index dae9ea3..8c6f593 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Lys-TTT @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,128 +51,128 @@ U - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - A + + A - - C + + C - - U + + U - - U + + U - - U + + U - - U + + U - - A + + A - - A + + A - - U + + U - - C + + C - - A + + A - - A + + A - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - C + + C G diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.json index 650b7f4..37756f4 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.json @@ -44,254 +44,254 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "U", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "U", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 18 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 19 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 20 }, { "base": "U", - "x": 102.19, - "y": 53.65, + "x": 124.03, + "y": 98.79, "pos": 21 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 22 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 23 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 24 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 25 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 26 }, { "base": "A", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 27 }, { "base": "C", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 28 }, { "base": "A", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 29 }, { "base": "U", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 30 }, { "base": "C", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 31 }, { "base": "A", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 32 }, { "base": "C", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 33 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 34 }, { "base": "C", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 35 }, { "base": "A", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 36 }, { "base": "U", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 37 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 38 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 39 }, { "base": "U", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 40 }, { "base": "G", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 41 }, { "base": "A", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 42 }, { "base": "U", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 43 }, { "base": "G", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 44 }, { "base": "G", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 45 }, { "base": "G", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 46 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 47 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 48 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 49 }, { @@ -464,7 +464,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -509,58 +509,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.svg index e47e6d7..b633d4f 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Met-CAT @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,131 +51,131 @@ G - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - C + + C - - A + + A - - U + + U - - C + + C - - A + + A - - C + + C - - U + + U - - C + + C - - A + + A - - U + + U - - A + + A - - A + + A - - U + + U - - G + + G - - A + + A - - U + + U - - G + + G - - G + + G - - G + + G - - G + + G - - U + + U - - C + + C A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.json index 21ad611..d5e752f 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.json @@ -44,248 +44,248 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "U", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "C", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 18 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 19 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 20 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 21 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 22 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 23 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 24 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 25 }, { "base": "A", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 26 }, { "base": "G", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 27 }, { "base": "G", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 28 }, { "base": "G", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 29 }, { "base": "G", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 30 }, { "base": "A", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 31 }, { "base": "U", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 32 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 33 }, { "base": "G", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 34 }, { "base": "A", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 35 }, { "base": "A", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 36 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 37 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 38 }, { "base": "U", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 39 }, { "base": "C", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 40 }, { "base": "C", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 41 }, { "base": "C", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 42 }, { "base": "C", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 43 }, { "base": "G", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 44 }, { "base": "U", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 45 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 46 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 47 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 48 }, { @@ -458,7 +458,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -503,58 +503,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.svg index f75c896..f4ae6df 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Phe-GAA @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,128 +51,128 @@ A - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - G + + G - - G + + G - - G + + G - - G + + G - - A + + A - - U + + U - - U + + U - - G + + G - - A + + A - - A + + A - - A + + A - - A + + A - - U + + U - - C + + C - - C + + C - - C + + C - - C + + C - - G + + G - - U + + U - - G + + G - - U + + U - - C + + C C diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.json index 04b2e17..38a6d0f 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.json @@ -44,254 +44,254 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "G", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "G", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "C", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "C", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "U", - "x": 95.64, - "y": 64.34, + "x": 113.78, + "y": 105.07, "pos": 18 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 19 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 20 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 21 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 22 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 23 }, { "base": "C", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 24 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 25 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 26 }, { "base": "A", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 27 }, { "base": "C", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 28 }, { "base": "U", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 29 }, { "base": "U", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 30 }, { "base": "C", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 31 }, { "base": "G", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 32 }, { "base": "U", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 33 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 34 }, { "base": "C", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 35 }, { "base": "G", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 36 }, { "base": "G", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 37 }, { "base": "G", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 38 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 39 }, { "base": "C", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 40 }, { "base": "G", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 41 }, { "base": "A", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 42 }, { "base": "A", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 43 }, { "base": "G", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 44 }, { "base": "G", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 45 }, { "base": "G", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 46 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 47 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 48 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 49 }, { @@ -464,7 +464,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -509,58 +509,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.svg index 5333c46..c84c8c2 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Pro-CGG @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,131 +51,131 @@ U - - U + + U - - G + + G - - G + + G - - C + + C - - G + + G - - C + + C - - A + + A - - G + + G - - C + + C - - C + + C - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - A + + A - - C + + C - - U + + U - - U + + U - - C + + C - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - G + + G - - G + + G - - A + + A - - C + + C - - G + + G - - A + + A - - A + + A - - G + + G - - G + + G - - G + + G - - G + + G - - U + + U - - C + + C G diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.json index 7d2c9ae..00f02a0 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.json @@ -44,254 +44,254 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "G", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "C", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "C", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "U", - "x": 95.64, - "y": 64.34, + "x": 113.78, + "y": 105.07, "pos": 18 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 19 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 20 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 21 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 22 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 23 }, { "base": "C", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 24 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 25 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 26 }, { "base": "A", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 27 }, { "base": "C", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 28 }, { "base": "C", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 29 }, { "base": "G", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 30 }, { "base": "U", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 31 }, { "base": "C", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 32 }, { "base": "A", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 33 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 34 }, { "base": "G", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 35 }, { "base": "G", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 36 }, { "base": "G", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 37 }, { "base": "G", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 38 }, { "base": "U", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 39 }, { "base": "G", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 40 }, { "base": "U", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 41 }, { "base": "C", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 42 }, { "base": "G", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 43 }, { "base": "G", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 44 }, { "base": "G", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 45 }, { "base": "G", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 46 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 47 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 48 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 49 }, { @@ -464,7 +464,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -509,58 +509,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.svg index ac97dd3..29f6565 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Pro-GGG @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,131 +51,131 @@ G - - U + + U - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - A + + A - - G + + G - - C + + C - - C + + C - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - G + + G - - U + + U - - C + + C - - A + + A - - U + + U - - G + + G - - G + + G - - G + + G - - G + + G - - U + + U - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - G + + G - - G + + G - - G + + G - - U + + U - - C + + C G diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.json index ff99fe8..a01af03 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.json @@ -44,254 +44,254 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "G", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "C", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "U", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "U", - "x": 95.64, - "y": 64.34, + "x": 113.78, + "y": 105.07, "pos": 18 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 19 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 20 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 21 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 22 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 23 }, { "base": "C", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 24 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 25 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 26 }, { "base": "A", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 27 }, { "base": "A", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 28 }, { "base": "C", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 29 }, { "base": "U", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 30 }, { "base": "G", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 31 }, { "base": "G", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 32 }, { "base": "U", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 33 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 34 }, { "base": "U", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 35 }, { "base": "G", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 36 }, { "base": "G", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 37 }, { "base": "G", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 38 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 39 }, { "base": "C", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 40 }, { "base": "C", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 41 }, { "base": "A", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 42 }, { "base": "G", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 43 }, { "base": "U", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 44 }, { "base": "G", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 45 }, { "base": "G", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 46 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 47 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 48 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 49 }, { @@ -464,7 +464,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -509,58 +509,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.svg index c40a0f6..fde6d58 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Pro-TGG @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,131 +51,131 @@ G - - U + + U - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - A + + A - - G + + G - - C + + C - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - A + + A - - A + + A - - C + + C - - U + + U - - G + + G - - G + + G - - U + + U - - U + + U - - U + + U - - G + + G - - G + + G - - G + + G - - A + + A - - C + + C - - C + + C - - A + + A - - G + + G - - U + + U - - G + + G - - G + + G - - G + + G - - U + + U - - C + + C G diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.json index 0f4f66d..1c9859f 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.json @@ -44,248 +44,248 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "U", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "U", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 18 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 19 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 20 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 21 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 22 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 23 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 24 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 25 }, { "base": "A", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 26 }, { "base": "G", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 27 }, { "base": "C", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 28 }, { "base": "G", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 29 }, { "base": "C", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 30 }, { "base": "A", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 31 }, { "base": "U", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 32 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 33 }, { "base": "C", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 34 }, { "base": "G", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 35 }, { "base": "U", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 36 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 37 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 38 }, { "base": "U", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 39 }, { "base": "G", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 40 }, { "base": "C", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 41 }, { "base": "G", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 42 }, { "base": "A", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 43 }, { "base": "A", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 44 }, { "base": "G", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 45 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 46 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 47 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 48 }, { @@ -458,7 +458,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -503,58 +503,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.svg index a660722..138b163 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Thr-CGT @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,128 +51,128 @@ A - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - A + + A - - U + + U - - U + + U - - C + + C - - G + + G - - U + + U - - A + + A - - A + + A - - U + + U - - G + + G - - C + + C - - G + + G - - A + + A - - A + + A - - G + + G - - G + + G - - U + + U - - C + + C G diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.json index b1a58eb..77955f3 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.json @@ -44,248 +44,248 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "U", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "U", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 18 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 19 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 20 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 21 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 22 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 23 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 24 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 25 }, { "base": "G", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 26 }, { "base": "C", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 27 }, { "base": "A", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 28 }, { "base": "C", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 29 }, { "base": "C", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 30 }, { "base": "C", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 31 }, { "base": "U", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 32 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 33 }, { "base": "G", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 34 }, { "base": "G", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 35 }, { "base": "U", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 36 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 37 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 38 }, { "base": "G", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 39 }, { "base": "G", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 40 }, { "base": "G", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 41 }, { "base": "U", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 42 }, { "base": "G", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 43 }, { "base": "A", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 44 }, { "base": "G", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 45 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 46 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 47 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 48 }, { @@ -458,7 +458,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -503,58 +503,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.svg index 472da5a..6c6c570 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Thr-GGT @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,128 +51,128 @@ A - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - C + + C - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - A + + A - - G + + G - - G + + G - - G + + G - - U + + U - - G + + G - - A + + A - - G + + G - - G + + G - - U + + U - - C + + C G diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.json index 32db0be..9a04202 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.json @@ -44,248 +44,248 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "U", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "A", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 18 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 19 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 20 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 21 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 22 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 23 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 24 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 25 }, { "base": "A", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 26 }, { "base": "A", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 27 }, { "base": "C", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 28 }, { "base": "U", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 29 }, { "base": "G", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 30 }, { "base": "A", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 31 }, { "base": "C", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 32 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 33 }, { "base": "U", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 34 }, { "base": "G", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 35 }, { "base": "U", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 36 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 37 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 38 }, { "base": "U", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 39 }, { "base": "C", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 40 }, { "base": "A", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 41 }, { "base": "G", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 42 }, { "base": "U", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 43 }, { "base": "A", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 44 }, { "base": "G", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 45 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 46 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 47 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 48 }, { @@ -458,7 +458,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -503,58 +503,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.svg index 52e8743..d13adeb 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Thr-TGT @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,128 +51,128 @@ U - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - A + + A - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - A + + A - - C + + C - - U + + U - - G + + G - - A + + A - - C + + C - - U + + U - - U + + U - - G + + G - - U + + U - - A + + A - - A + + A - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - A + + A - - G + + G - - G + + G - - U + + U - - C + + C A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.json index 314c4dc..b6b29cf 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.json @@ -44,248 +44,248 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "U", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "A", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "U", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "U", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 18 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 19 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 20 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 21 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 22 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 23 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 24 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 25 }, { "base": "A", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 26 }, { "base": "C", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 27 }, { "base": "C", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 28 }, { "base": "G", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 29 }, { "base": "G", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 30 }, { "base": "U", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 31 }, { "base": "C", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 32 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 33 }, { "base": "C", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 34 }, { "base": "C", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 35 }, { "base": "A", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 36 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 37 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 38 }, { "base": "A", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 39 }, { "base": "C", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 40 }, { "base": "C", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 41 }, { "base": "G", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 42 }, { "base": "G", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 43 }, { "base": "G", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 44 }, { "base": "U", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 45 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 46 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 47 }, { "base": "U", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 48 }, { @@ -458,7 +458,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -503,58 +503,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.svg index 49e7c87..7cb8e1a 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Trp-CCA @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,128 +51,128 @@ G - - U + + U - - A + + A - - G + + G - - U + + U - - U + + U - - C + + C - - A + + A - - A + + A - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - G + + G - - G + + G - - U + + U - - C + + C - - U + + U - - C + + C - - C + + C - - A + + A - - A + + A - - A + + A - - A + + A - - C + + C - - C + + C - - G + + G - - G + + G - - G + + G - - U + + U - - G + + G - - U + + U - - U + + U G diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.json index 66231ae..22d7732 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.json @@ -44,254 +44,254 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "U", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "U", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 18 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 19 }, { "base": "U", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 20 }, { "base": "U", - "x": 102.19, - "y": 53.65, + "x": 124.03, + "y": 98.79, "pos": 21 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 22 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 23 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 24 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 25 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 26 }, { "base": "A", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 27 }, { "base": "C", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 28 }, { "base": "C", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 29 }, { "base": "A", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 30 }, { "base": "C", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 31 }, { "base": "C", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 32 }, { "base": "U", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 33 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 34 }, { "base": "G", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 35 }, { "base": "A", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 36 }, { "base": "C", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 37 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 38 }, { "base": "U", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 39 }, { "base": "G", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 40 }, { "base": "G", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 41 }, { "base": "U", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 42 }, { "base": "G", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 43 }, { "base": "G", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 44 }, { "base": "G", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 45 }, { "base": "G", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 46 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 47 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 48 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 49 }, { @@ -464,7 +464,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -509,58 +509,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.svg index 46a99fd..1b94d14 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Val-GAC @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,131 +51,131 @@ G - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - A + + A - - C + + C - - C + + C - - U + + U - - U + + U - - G + + G - - A + + A - - C + + C - - A + + A - - U + + U - - G + + G - - G + + G - - U + + U - - G + + G - - G + + G - - G + + G - - G + + G - - G + + G - - U + + U - - C + + C G diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.json index e117712..969c874 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.json @@ -44,248 +44,248 @@ }, { "base": "U", - "x": 146.62, - "y": 49.76, + "x": 135.77, + "y": 51.36, "pos": 8 }, { "base": "A", - "x": 139.81, - "y": 56.96, + "x": 121.89, + "y": 60.16, "pos": 9 }, { "base": "G", - "x": 134.52, - "y": 60.56, + "x": 110.0, + "y": 64.56, "pos": 10 }, { "base": "C", - "x": 126.96, - "y": 60.56, + "x": 110.0, + "y": 72.12, "pos": 11 }, { "base": "U", - "x": 119.4, - "y": 60.56, + "x": 110.0, + "y": 79.68, "pos": 12 }, { "base": "C", - "x": 111.84, - "y": 60.56, + "x": 110.0, + "y": 87.24, "pos": 13 }, { "base": "A", - "x": 105.3, - "y": 76.11, + "x": 102.5, + "y": 95.81, "pos": 14 }, { "base": "G", - "x": 100.97, - "y": 74.32, + "x": 104.22, + "y": 99.95, "pos": 15 }, { "base": "C", - "x": 97.66, - "y": 71.01, + "x": 107.39, + "y": 103.13, "pos": 16 }, { "base": "U", - "x": 95.87, - "y": 66.68, + "x": 111.54, + "y": 104.84, "pos": 17 }, { "base": "G", - "x": 95.87, - "y": 62.0, + "x": 116.02, + "y": 104.84, "pos": 18 }, { "base": "G", - "x": 97.66, - "y": 57.67, + "x": 120.17, + "y": 103.13, "pos": 19 }, { "base": "G", - "x": 100.97, - "y": 54.36, + "x": 123.34, + "y": 99.95, "pos": 20 }, { "base": "A", - "x": 105.3, - "y": 52.57, + "x": 125.06, + "y": 95.81, "pos": 21 }, { "base": "G", - "x": 111.84, - "y": 68.12, + "x": 117.56, + "y": 87.24, "pos": 22 }, { "base": "A", - "x": 119.4, - "y": 68.12, + "x": 117.56, + "y": 79.68, "pos": 23 }, { "base": "G", - "x": 126.96, - "y": 68.12, + "x": 117.56, + "y": 72.12, "pos": 24 }, { "base": "C", - "x": 134.52, - "y": 68.12, + "x": 117.56, + "y": 64.56, "pos": 25 }, { "base": "A", - "x": 133.13, - "y": 80.22, + "x": 127.78, + "y": 62.06, "pos": 26 }, { "base": "C", - "x": 132.0, - "y": 90.12, + "x": 138.0, + "y": 64.56, "pos": 27 }, { "base": "C", - "x": 132.0, - "y": 97.68, + "x": 138.0, + "y": 72.12, "pos": 28 }, { "base": "U", - "x": 132.0, - "y": 105.24, + "x": 138.0, + "y": 79.68, "pos": 29 }, { "base": "C", - "x": 132.0, - "y": 112.8, + "x": 138.0, + "y": 87.24, "pos": 30 }, { "base": "C", - "x": 132.0, - "y": 120.36, + "x": 138.0, + "y": 94.8, "pos": 31 }, { "base": "C", - "x": 123.11, - "y": 127.8, + "x": 129.11, + "y": 102.24, "pos": 32 }, { "base": "U", - "x": 125.62, - "y": 133.02, + "x": 131.62, + "y": 107.46, "pos": 33 }, { "base": "U", - "x": 130.14, - "y": 136.62, + "x": 136.14, + "y": 111.06, "pos": 34 }, { "base": "A", - "x": 135.78, - "y": 137.91, + "x": 141.78, + "y": 112.35, "pos": 35 }, { "base": "C", - "x": 141.42, - "y": 136.62, + "x": 147.42, + "y": 111.06, "pos": 36 }, { "base": "A", - "x": 145.94, - "y": 133.02, + "x": 151.94, + "y": 107.46, "pos": 37 }, { "base": "A", - "x": 148.45, - "y": 127.8, + "x": 154.45, + "y": 102.24, "pos": 38 }, { "base": "G", - "x": 139.56, - "y": 120.36, + "x": 145.56, + "y": 94.8, "pos": 39 }, { "base": "G", - "x": 139.56, - "y": 112.8, + "x": 145.56, + "y": 87.24, "pos": 40 }, { "base": "A", - "x": 139.56, - "y": 105.24, + "x": 145.56, + "y": 79.68, "pos": 41 }, { "base": "G", - "x": 139.56, - "y": 97.68, + "x": 145.56, + "y": 72.12, "pos": 42 }, { "base": "G", - "x": 139.56, - "y": 90.12, + "x": 145.56, + "y": 64.56, "pos": 43 }, { "base": "G", - "x": 143.49, - "y": 81.05, + "x": 149.43, + "y": 58.05, "pos": 44 }, { "base": "G", - "x": 148.55, - "y": 73.51, + "x": 154.01, + "y": 55.62, "pos": 45 }, { "base": "G", - "x": 149.87, - "y": 65.96, + "x": 154.37, + "y": 53.18, "pos": 46 }, { "base": "U", - "x": 147.44, - "y": 58.42, + "x": 150.5, + "y": 50.75, "pos": 47 }, { "base": "C", - "x": 141.27, - "y": 50.87, + "x": 142.41, + "y": 48.31, "pos": 48 }, { @@ -458,7 +458,7 @@ } ], "width": 215.0, - "height": 157.91, + "height": 132.35, "lines": [ { "x1": 197.38, @@ -503,58 +503,58 @@ "y2": 34.94 }, { - "x1": 136.89, - "y1": 60.5, - "x2": 136.89, - "y2": 63.06 + "x1": 114.88, + "y1": 62.0, + "x2": 117.44, + "y2": 62.0 }, { - "x1": 129.33, - "y1": 60.5, - "x2": 129.33, - "y2": 63.06 + "x1": 114.88, + "y1": 69.56, + "x2": 117.44, + "y2": 69.56 }, { - "x1": 121.77, - "y1": 60.5, - "x2": 121.77, - "y2": 63.06 + "x1": 114.88, + "y1": 77.12, + "x2": 117.44, + "y2": 77.12 }, { - "x1": 114.21, - "y1": 60.5, - "x2": 114.21, - "y2": 63.06 + "x1": 114.88, + "y1": 84.68, + "x2": 117.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 87.56, - "x2": 139.44, - "y2": 87.56 + "x1": 142.88, + "y1": 62.0, + "x2": 145.44, + "y2": 62.0 }, { - "x1": 136.88, - "y1": 95.12, - "x2": 139.44, - "y2": 95.12 + "x1": 142.88, + "y1": 69.56, + "x2": 145.44, + "y2": 69.56 }, { - "x1": 136.88, - "y1": 102.68, - "x2": 139.44, - "y2": 102.68 + "x1": 142.88, + "y1": 77.12, + "x2": 145.44, + "y2": 77.12 }, { - "x1": 136.88, - "y1": 110.24, - "x2": 139.44, - "y2": 110.24 + "x1": 142.88, + "y1": 84.68, + "x2": 145.44, + "y2": 84.68 }, { - "x1": 136.88, - "y1": 117.8, - "x2": 139.44, - "y2": 117.8 + "x1": 142.88, + "y1": 92.23, + "x2": 145.44, + "y2": 92.23 }, { "x1": 141.43, diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.svg index 5c51067..a4fe8b4 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.svg @@ -4,7 +4,7 @@ xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="215.0" - height="157.91" + height="132.35" xml:space="preserve"> tRNA-Val-TAC @@ -16,15 +16,15 @@ - - - - - - - - - + + + + + + + + + @@ -51,128 +51,128 @@ U - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - C + + C - - U + + U - - G + + G - - G + + G - - G + + G - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - U + + U - - C + + C - - C + + C - - C + + C - - U + + U - - U + + U - - A + + A - - C + + C - - A + + A - - A + + A - - G + + G - - G + + G - - A + + A - - G + + G - - G + + G - - G + + G - - G + + G - - G + + G - - U + + U - - C + + C G From ad6d7ef073a7a09b2415adabf25ba97ff54a2661 Mon Sep 17 00:00:00 2001 From: Jay Hesselberth Date: Sun, 10 May 2026 10:24:10 -0600 Subject: [PATCH 3/3] Widen elbow layout spacing to fit modification annotations MIME-Version: 1.0 Content-Type: text/plain; charset=UTF-8 Content-Transfer-Encoding: 8bit The first elbow layout had loop residues only 4-5 SVG units apart and the variable region as tight as 2.5 units — too tight for the radius-4.3 modification circles and stroke outlines drawn by plot_tRNA_structure(). Fixes: * Loop radii now solved analytically so chord between adjacent residues equals the backbone spacing S: R = S / (2 sin(π/(2N))) for N residues on a 180° arc. Previous formula (N-1)*S/π underestimated R by ~17%. * Variable region (44..48) now sampled by ARC LENGTH along the bezier rather than by uniform t, so neighbors are evenly spaced instead of bunching at the apex. * Wider canvas (240×170 vs 215×132) and deeper D-arm/AC-arm (D_TOP_Y pushed down by 14 units) give the variable-region path enough room. * Acceptor stem widened (ACC_X1 220 vs 195) for more horizontal room. Result: minimum neighbor distance is now 7.55 (matching the cloverleaf median of 7.56), so modification circles fit without overlapping neighboring letters. Co-Authored-By: Claude Opus 4.7 (1M context) --- data-raw/structures/generate_elbow.py | 91 ++-- .../Escherichia_coli/elbow/tRNA-Ala-GGC.json | 476 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Ala-GGC.svg | 350 ++++++------- .../Escherichia_coli/elbow/tRNA-Ala-TGC.json | 476 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Ala-TGC.svg | 350 ++++++------- .../Escherichia_coli/elbow/tRNA-Arg-ACG.json | 480 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Arg-ACG.svg | 354 ++++++------- .../Escherichia_coli/elbow/tRNA-Arg-CCG.json | 480 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Arg-CCG.svg | 354 ++++++------- .../Escherichia_coli/elbow/tRNA-Arg-CCT.json | 472 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Arg-CCT.svg | 346 ++++++------- .../Escherichia_coli/elbow/tRNA-Arg-TCT.json | 480 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Arg-TCT.svg | 354 ++++++------- .../Escherichia_coli/elbow/tRNA-Asn-GTT.json | 476 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Asn-GTT.svg | 350 ++++++------- .../Escherichia_coli/elbow/tRNA-Asp-GTC.json | 480 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Asp-GTC.svg | 354 ++++++------- .../Escherichia_coli/elbow/tRNA-Cys-GCA.json | 468 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Cys-GCA.svg | 342 ++++++------- .../Escherichia_coli/elbow/tRNA-Gln-CTG.json | 472 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Gln-CTG.svg | 346 ++++++------- .../Escherichia_coli/elbow/tRNA-Gln-TTG.json | 472 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Gln-TTG.svg | 346 ++++++------- .../Escherichia_coli/elbow/tRNA-Glu-TTC.json | 476 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Glu-TTC.svg | 350 ++++++------- .../Escherichia_coli/elbow/tRNA-Gly-CCC.json | 468 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Gly-CCC.svg | 342 ++++++------- .../Escherichia_coli/elbow/tRNA-Gly-GCC.json | 476 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Gly-GCC.svg | 350 ++++++------- .../Escherichia_coli/elbow/tRNA-Gly-TCC.json | 472 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Gly-TCC.svg | 346 ++++++------- .../Escherichia_coli/elbow/tRNA-His-GTG.json | 476 ++++++++--------- .../Escherichia_coli/elbow/tRNA-His-GTG.svg | 350 ++++++------- .../Escherichia_coli/elbow/tRNA-Ile-GAT.json | 480 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Ile-GAT.svg | 354 ++++++------- .../Escherichia_coli/elbow/tRNA-Lys-TTT.json | 476 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Lys-TTT.svg | 350 ++++++------- .../Escherichia_coli/elbow/tRNA-Met-CAT.json | 480 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Met-CAT.svg | 354 ++++++------- .../Escherichia_coli/elbow/tRNA-Phe-GAA.json | 476 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Phe-GAA.svg | 350 ++++++------- .../Escherichia_coli/elbow/tRNA-Pro-CGG.json | 480 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Pro-CGG.svg | 354 ++++++------- .../Escherichia_coli/elbow/tRNA-Pro-GGG.json | 480 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Pro-GGG.svg | 354 ++++++------- .../Escherichia_coli/elbow/tRNA-Pro-TGG.json | 480 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Pro-TGG.svg | 354 ++++++------- .../Escherichia_coli/elbow/tRNA-Thr-CGT.json | 476 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Thr-CGT.svg | 350 ++++++------- .../Escherichia_coli/elbow/tRNA-Thr-GGT.json | 476 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Thr-GGT.svg | 350 ++++++------- .../Escherichia_coli/elbow/tRNA-Thr-TGT.json | 476 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Thr-TGT.svg | 350 ++++++------- .../Escherichia_coli/elbow/tRNA-Trp-CCA.json | 476 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Trp-CCA.svg | 350 ++++++------- .../Escherichia_coli/elbow/tRNA-Val-GAC.json | 480 +++++++++--------- .../Escherichia_coli/elbow/tRNA-Val-GAC.svg | 354 ++++++------- .../Escherichia_coli/elbow/tRNA-Val-TAC.json | 476 ++++++++--------- .../Escherichia_coli/elbow/tRNA-Val-TAC.svg | 350 ++++++------- 59 files changed, 12046 insertions(+), 12015 deletions(-) diff --git a/data-raw/structures/generate_elbow.py b/data-raw/structures/generate_elbow.py index c88090c..688c781 100644 --- a/data-raw/structures/generate_elbow.py +++ b/data-raw/structures/generate_elbow.py @@ -49,13 +49,16 @@ P = 7.56 # vertical pair spacing between rows of a stem # Combined acceptor + T helix at top -TOP_Y = 35.0 # 3' strand row (acceptor 3' + T-stem 3'); CCA emerges UP from here +TOP_Y = 40.0 # 3' strand row (acceptor 3' + T-stem 3'); CCA emerges UP from here BOT_Y = TOP_Y + P # 5' strand row (acceptor 5' + T-stem 5'); side arms emerge DOWN from here -ACC_X1 = 195.0 # x of pos 1 (5' free end) and pos 72 (paired with pos 1) -GAP = S * 1.4 # break between T-stem and acceptor on the bottom strand +ACC_X1 = 220.0 # x of pos 1 (5' free end) and pos 72 (paired with pos 1) +GAP = S * 1.6 # break between T-stem and acceptor on the bottom strand -# T-loop (54..60) curls at far LEFT of the combined helix -T_LOOP_RADIUS = 13.0 +# T-loop (54..60) curls at far LEFT of the combined helix. With N residues +# placed on a 180° arc at t = (k+0.5)/N, neighbors are 2R*sin(π/(2N)) apart. +# Solve for R so chord = S → R = S / (2 sin(π/(2N))). Matches the cloverleaf +# spacing so mod circles (radius 4.3) fit cleanly. +T_LOOP_RADIUS = S / (2 * math.sin(math.pi / 14)) # 7 residues # Both D-arm and AC-arm hang DOWN as parallel vertical helices below the top # stack — D-arm to the LEFT (smaller, 4 bp + D-loop at the bottom-left), @@ -63,15 +66,19 @@ # the horizontal acceptor+T helix at the top this gives the canonical L-shape # elbow projection seen in textbook tRNA depictions (e.g., Matsumoto 2026 # JBC fig 2A). -D_X_LEFT = 110.0 # left column of D-stem (pos 10-13) +# +# Spacing is generous enough that the radius-4.3 modification circles and +# radius ~5 outline circles used by plot_tRNA_structure() do not collide +# with neighboring nucleotide letters. +D_X_LEFT = 130.0 # left column of D-stem (pos 10-13) D_X_RIGHT = D_X_LEFT + P -D_TOP_Y = BOT_Y + 22.0 -D_LOOP_RADIUS = 11.5 +D_TOP_Y = BOT_Y + 50.0 +D_LOOP_RADIUS = S / (2 * math.sin(math.pi / 16)) # 8 residues on 180° arc -AC_X_LEFT = 138.0 +AC_X_LEFT = 158.0 AC_X_RIGHT = AC_X_LEFT + P AC_TOP_Y = D_TOP_Y # AC-arm aligned vertically with D-arm -AC_LOOP_RADIUS = 13.0 +AC_LOOP_RADIUS = S / (2 * math.sin(math.pi / 14)) # 7 residues on 180° arc # --- variable-arm detection -------------------------------------------- @@ -317,15 +324,14 @@ def elbow_coord_table() -> dict[str, tuple[float, float]]: # bulges LEFT and DOWN from the bottom of the stem, matching the # canonical L-shape projection. # Hinges 8, 9 are the diagonal connector from pos 7 (top stack, bot row, - # at acc_left_x) DOWN-LEFT to pos 10 (top-left of D-arm). - coords["8"] = ( - acc_left_x - (acc_left_x - D_X_LEFT) * 0.35, - BOT_Y + (D_TOP_Y - BOT_Y) * 0.4, - ) - coords["9"] = ( - acc_left_x - (acc_left_x - D_X_LEFT) * 0.7, - BOT_Y + (D_TOP_Y - BOT_Y) * 0.8, - ) + # at acc_left_x) DOWN-LEFT to pos 10 (top-left of D-arm). Place evenly + # along the line so consecutive backbone neighbors are similarly spaced. + for k, n in enumerate(("8", "9"), start=1): + t = k / 3.0 # 1/3 and 2/3 along the line from pos 7 to pos 10 + coords[n] = ( + acc_left_x + (D_X_LEFT - acc_left_x) * t, + BOT_Y + (D_TOP_Y - BOT_Y) * t, + ) # D-stem 5' (10..13) on LEFT column, top-to-bottom for n in range(10, 14): coords[str(n)] = (D_X_LEFT, D_TOP_Y + (n - 10) * S) @@ -403,20 +409,45 @@ def elbow_coord_table() -> dict[str, tuple[float, float]]: coords[str(n)] = (x, y) # ----- variable region (44..48): smooth curve from AC-stem 3' top to pos 49 ----- - # AC_X_LEFT was chosen so AC-arm sits roughly under the elbow region of the - # top stack; the variable region is then a bulge from pos 43 (top-right of - # AC-stem) up to pos 49 (T-stem 5' end on bottom row of top stack). The - # bezier control point is pushed well to the RIGHT so the path bows away - # from the AC-stem 3' column rather than overlapping it. - var_start = (AC_X_RIGHT, AC_TOP_Y - 0.7 * S) - var_end = (t_right_x - 0.3 * S, BOT_Y + 0.6 * S) - ctrl_x = max(var_start[0], var_end[0]) + 22 + # The bulge runs from pos 43 (top-right of AC-stem) up to pos 49 (T-stem + # 5' end on bottom row of top stack). Quadratic bezier with control + # point bowed RIGHT so the path doesn't crowd the AC-stem 3' column. + # Positions are placed by ARC-LENGTH along the curve so consecutive + # neighbors are evenly spaced (a t-uniform sampling clusters at the apex). + var_start = (AC_X_RIGHT, AC_TOP_Y - 0.6 * S) + var_end = (t_right_x + 0.3 * S, BOT_Y + 0.6 * S) + ctrl_x = max(var_start[0], var_end[0]) + 18 ctrl_y = (var_start[1] + var_end[1]) / 2 - for k, n in enumerate(range(44, 49)): - t = (k + 0.5) / 5 + + def bez(t: float) -> tuple[float, float]: x = (1 - t) ** 2 * var_start[0] + 2 * (1 - t) * t * ctrl_x + t ** 2 * var_end[0] y = (1 - t) ** 2 * var_start[1] + 2 * (1 - t) * t * ctrl_y + t ** 2 * var_end[1] - coords[str(n)] = (x, y) + return x, y + + # Sample the curve densely to build an arc-length lookup + n_samples = 200 + samples = [bez(i / n_samples) for i in range(n_samples + 1)] + cum_lengths = [0.0] + for a, b in zip(samples, samples[1:]): + cum_lengths.append(cum_lengths[-1] + math.hypot(b[0] - a[0], b[1] - a[1])) + total_length = cum_lengths[-1] + + def t_for_arc(target_arc: float) -> float: + for i, L in enumerate(cum_lengths): + if L >= target_arc: + # linear interpolate t around index i + if i == 0: + return 0.0 + prev = cum_lengths[i - 1] + frac = (target_arc - prev) / (L - prev) if L > prev else 0.0 + return ((i - 1) + frac) / n_samples + return 1.0 + + # 5 residues, evenly spaced along the curve (1/6, 2/6, ..., 5/6 of total) + for k, n in enumerate(range(44, 49), start=1): + target = total_length * k / 6 + t = t_for_arc(target) + coords[str(n)] = bez(t) return coords diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.json index c61efd8..ebf223b 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.json @@ -2,589 +2,589 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "G", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "G", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "G", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "C", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "U", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "A", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "C", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "U", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 18 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 19 }, { "base": "G", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 20 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 21 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 22 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 23 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 24 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 25 }, { "base": "G", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 26 }, { "base": "C", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 27 }, { "base": "U", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 28 }, { "base": "U", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 29 }, { "base": "G", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 30 }, { "base": "C", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 31 }, { "base": "A", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 32 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 33 }, { "base": "G", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 34 }, { "base": "G", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 35 }, { "base": "C", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 36 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 37 }, { "base": "U", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 38 }, { "base": "G", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 39 }, { "base": "C", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 40 }, { "base": "A", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 41 }, { "base": "A", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 42 }, { "base": "G", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 43 }, { "base": "A", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 44 }, { "base": "G", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 45 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 46 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 47 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 48 }, { "base": "A", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 49 }, { "base": "G", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 50 }, { "base": "C", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 51 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 53 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 54 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 55 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 56 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 57 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 58 }, { "base": "U", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 59 }, { "base": "C", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 60 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 61 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 62 }, { "base": "G", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 63 }, { "base": "C", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 64 }, { "base": "U", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 65 }, { "base": "U", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 66 }, { "base": "A", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 67 }, { "base": "G", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 68 }, { "base": "C", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 69 }, { "base": "U", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 70 }, { "base": "C", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 71 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 72 }, { "base": "A", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 73 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 75 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 76 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Ala-GGC", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.svg index eb7b211..3093a23 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-GGC.svg @@ -3,259 +3,259 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Ala-GGC - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - G + + G - - G + + G - - G + + G - - C + + C - - U + + U - - A + + A - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - C + + C - - U + + U - - G + + G - - G + + G - - G + + G - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - U + + U - - U + + U - - G + + G - - C + + C - - A + + A - - U + + U - - G + + G - - G + + G - - C + + C - - A + + A - - U + + U - - G + + G - - C + + C - - A + + A - - A + + A - - G + + G - - A + + A - - G + + G - - G + + G - - U + + U - - C + + C - - A + + A - - G + + G - - C + + C - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - U + + U - - C + + C - - C + + C - - C + + C - - G + + G - - C + + C - - U + + U - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - C + + C - - A + + A - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.json index cddfc49..c334078 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.json @@ -2,589 +2,589 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "G", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "G", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "G", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "C", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "U", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "A", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "C", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "U", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 18 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 19 }, { "base": "G", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 20 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 21 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 22 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 23 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 24 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 25 }, { "base": "G", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 26 }, { "base": "C", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 27 }, { "base": "C", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 28 }, { "base": "U", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 29 }, { "base": "G", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 30 }, { "base": "C", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 31 }, { "base": "U", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 32 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 33 }, { "base": "U", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 34 }, { "base": "G", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 35 }, { "base": "C", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 36 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 37 }, { "base": "C", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 38 }, { "base": "G", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 39 }, { "base": "C", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 40 }, { "base": "A", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 41 }, { "base": "G", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 42 }, { "base": "G", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 43 }, { "base": "A", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 44 }, { "base": "G", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 45 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 46 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 47 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 48 }, { "base": "U", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 49 }, { "base": "G", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 50 }, { "base": "C", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 51 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 53 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 54 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 55 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 56 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 57 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 58 }, { "base": "U", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 59 }, { "base": "C", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 60 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 61 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 62 }, { "base": "G", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 63 }, { "base": "C", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 64 }, { "base": "A", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 65 }, { "base": "U", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 66 }, { "base": "A", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 67 }, { "base": "G", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 68 }, { "base": "C", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 69 }, { "base": "U", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 70 }, { "base": "C", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 71 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 72 }, { "base": "A", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 73 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 75 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 76 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Ala-TGC", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.svg index 866f449..466700c 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ala-TGC.svg @@ -3,259 +3,259 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Ala-TGC - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - G + + G - - G + + G - - G + + G - - C + + C - - U + + U - - A + + A - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - C + + C - - U + + U - - G + + G - - G + + G - - G + + G - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - C + + C - - U + + U - - G + + G - - C + + C - - U + + U - - U + + U - - U + + U - - G + + G - - C + + C - - A + + A - - C + + C - - G + + G - - C + + C - - A + + A - - G + + G - - G + + G - - A + + A - - G + + G - - G + + G - - U + + U - - C + + C - - U + + U - - G + + G - - C + + C - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - U + + U - - C + + C - - C + + C - - C + + C - - G + + G - - C + + C - - A + + A - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - C + + C - - A + + A - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.json index dee9324..6a08602 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.json @@ -2,595 +2,595 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "C", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "A", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "U", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "C", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "C", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "G", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "C", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "U", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 18 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 19 }, { "base": "A", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 20 }, { "base": "U", - "x": 124.03, - "y": 98.79, + "x": 151.04, + "y": 139.69, "pos": 21 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 22 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 23 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 24 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 25 }, { "base": "U", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 26 }, { "base": "A", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 27 }, { "base": "C", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 28 }, { "base": "U", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 29 }, { "base": "C", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 30 }, { "base": "G", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 31 }, { "base": "G", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 32 }, { "base": "C", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 33 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 34 }, { "base": "A", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 35 }, { "base": "C", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 36 }, { "base": "G", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 37 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 38 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 39 }, { "base": "C", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 40 }, { "base": "C", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 41 }, { "base": "G", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 42 }, { "base": "A", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 43 }, { "base": "G", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 44 }, { "base": "C", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 45 }, { "base": "G", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 46 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 47 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 48 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 49 }, { "base": "G", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 50 }, { "base": "G", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 51 }, { "base": "A", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 53 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 54 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 55 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 56 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 57 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 58 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 59 }, { "base": "A", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 60 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 61 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 62 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 63 }, { "base": "U", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 64 }, { "base": "C", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 65 }, { "base": "C", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 66 }, { "base": "C", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 67 }, { "base": "G", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 68 }, { "base": "G", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 69 }, { "base": "A", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 70 }, { "base": "U", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 71 }, { "base": "G", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 72 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 73 }, { "base": "A", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 75 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 76 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 77 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Arg-ACG", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.svg index ae0973d..e659989 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-ACG.svg @@ -3,262 +3,262 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Arg-ACG - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - C + + C - - A + + A - - U + + U - - C + + C - - C + + C - - G + + G - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - C + + C - - U + + U - - G + + G - - G + + G - - A + + A - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - U + + U - - A + + A - - C + + C - - U + + U - - C + + C - - G + + G - - G + + G - - C + + C - - U + + U - - A + + A - - C + + C - - G + + G - - A + + A - - A + + A - - C + + C - - C + + C - - G + + G - - A + + A - - G + + G - - C + + C - - G + + G - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - A + + A - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - A + + A - - U + + U - - C + + C - - C + + C - - U + + U - - C + + C - - C + + C - - C + + C - - G + + G - - G + + G - - A + + A - - U + + U - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.json index 42c8626..d305268 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.json @@ -2,595 +2,595 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "C", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "G", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "C", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "C", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "C", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "G", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "C", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "U", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 18 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 19 }, { "base": "A", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 20 }, { "base": "U", - "x": 124.03, - "y": 98.79, + "x": 151.04, + "y": 139.69, "pos": 21 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 22 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 23 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 24 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 25 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 26 }, { "base": "G", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 27 }, { "base": "C", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 28 }, { "base": "U", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 29 }, { "base": "G", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 30 }, { "base": "C", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 31 }, { "base": "C", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 32 }, { "base": "C", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 33 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 34 }, { "base": "C", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 35 }, { "base": "C", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 36 }, { "base": "G", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 37 }, { "base": "G", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 38 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 39 }, { "base": "G", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 40 }, { "base": "G", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 41 }, { "base": "C", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 42 }, { "base": "A", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 43 }, { "base": "G", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 44 }, { "base": "A", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 45 }, { "base": "G", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 46 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 47 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 48 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 49 }, { "base": "U", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 50 }, { "base": "C", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 51 }, { "base": "A", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 53 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 54 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 55 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 56 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 57 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 58 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 59 }, { "base": "A", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 60 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 61 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 62 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 63 }, { "base": "U", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 64 }, { "base": "G", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 65 }, { "base": "U", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 66 }, { "base": "C", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 67 }, { "base": "G", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 68 }, { "base": "G", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 69 }, { "base": "G", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 70 }, { "base": "C", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 71 }, { "base": "G", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 72 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 73 }, { "base": "G", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 75 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 76 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 77 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Arg-CCG", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.svg index 5248a3f..96ed47b 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCG.svg @@ -3,262 +3,262 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Arg-CCG - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - C + + C - - G + + G - - C + + C - - C + + C - - C + + C - - G + + G - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - C + + C - - U + + U - - G + + G - - G + + G - - A + + A - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - U + + U - - G + + G - - C + + C - - C + + C - - C + + C - - U + + U - - C + + C - - C + + C - - G + + G - - G + + G - - A + + A - - G + + G - - G + + G - - C + + C - - A + + A - - G + + G - - A + + A - - G + + G - - G + + G - - U + + U - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - A + + A - - U + + U - - C + + C - - C + + C - - U + + U - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - G + + G - - C + + C - - G + + G - - C + + C - - G + + G - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.json index 9fdff5b..0609669 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.json @@ -2,583 +2,583 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "U", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "C", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "C", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "U", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "C", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "U", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "U", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "A", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "A", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "U", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 18 }, { "base": "A", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 19 }, { "base": "U", - "x": 124.03, - "y": 98.79, + "x": 151.04, + "y": 139.69, "pos": 20 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 21 }, { "base": "U", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 22 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 23 }, { "base": "A", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 24 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 25 }, { "base": "G", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 26 }, { "base": "A", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 27 }, { "base": "G", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 28 }, { "base": "C", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 29 }, { "base": "C", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 30 }, { "base": "C", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 31 }, { "base": "C", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 32 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 33 }, { "base": "C", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 34 }, { "base": "C", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 35 }, { "base": "U", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 36 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 37 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 38 }, { "base": "G", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 39 }, { "base": "G", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 40 }, { "base": "G", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 41 }, { "base": "C", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 42 }, { "base": "U", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 43 }, { "base": "A", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 44 }, { "base": "A", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 45 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 46 }, { "base": "U", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 47 }, { "base": "G", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 48 }, { "base": "C", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 49 }, { "base": "A", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 50 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 51 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 52 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 53 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 54 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 55 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 56 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 57 }, { "base": "U", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 58 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 59 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 60 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 61 }, { "base": "U", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 62 }, { "base": "G", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 63 }, { "base": "C", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 64 }, { "base": "A", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 65 }, { "base": "G", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 66 }, { "base": "G", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 67 }, { "base": "G", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 68 }, { "base": "G", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 69 }, { "base": "A", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 70 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 71 }, { "base": "A", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 72 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 73 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 74 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 75 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Arg-CCT", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.svg index 3657b64..40be1e2 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-CCT.svg @@ -3,256 +3,256 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Arg-CCT - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - U + + U - - C + + C - - C + + C - - U + + U - - C + + C - - U + + U - - U + + U - - A + + A - - G + + G - - U + + U - - U + + U - - A + + A - - A + + A - - A + + A - - U + + U - - G + + G - - G + + G - - A + + A - - U + + U - - A + + A - - U + + U - - A + + A - - A + + A - - C + + C - - G + + G - - A + + A - - G + + G - - C + + C - - C + + C - - C + + C - - C + + C - - U + + U - - C + + C - - C + + C - - U + + U - - A + + A - - A + + A - - G + + G - - G + + G - - G + + G - - C + + C - - U + + U - - A + + A - - A + + A - - U + + U - - U + + U - - G + + G - - C + + C - - A + + A - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - U + + U - - U + + U - - C + + C - - C + + C - - U + + U - - G + + G - - C + + C - - A + + A - - G + + G - - G + + G - - G + + G - - G + + G - - A + + A - - C + + C - - A + + A - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.json index dec1aaf..9f71576 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.json @@ -2,595 +2,595 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "C", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "G", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "C", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "C", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "C", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "U", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "U", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "U", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 18 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 19 }, { "base": "A", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 20 }, { "base": "U", - "x": 124.03, - "y": 98.79, + "x": 151.04, + "y": 139.69, "pos": 21 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 22 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 23 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 24 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 25 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 26 }, { "base": "A", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 27 }, { "base": "A", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 28 }, { "base": "C", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 29 }, { "base": "G", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 30 }, { "base": "A", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 31 }, { "base": "C", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 32 }, { "base": "C", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 33 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 34 }, { "base": "U", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 35 }, { "base": "C", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 36 }, { "base": "U", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 37 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 38 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 39 }, { "base": "G", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 40 }, { "base": "U", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 41 }, { "base": "C", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 42 }, { "base": "G", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 43 }, { "base": "U", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 44 }, { "base": "G", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 45 }, { "base": "G", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 46 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 47 }, { "base": "C", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 48 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 49 }, { "base": "G", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 50 }, { "base": "C", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 51 }, { "base": "A", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 53 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 54 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 55 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 56 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 57 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 58 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 59 }, { "base": "A", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 60 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 61 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 62 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 63 }, { "base": "U", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 64 }, { "base": "G", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 65 }, { "base": "C", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 66 }, { "base": "A", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 67 }, { "base": "G", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 68 }, { "base": "G", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 69 }, { "base": "G", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 70 }, { "base": "C", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 71 }, { "base": "G", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 72 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 73 }, { "base": "G", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 75 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 76 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 77 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Arg-TCT", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.svg index bad15ec..c1bb15d 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Arg-TCT.svg @@ -3,262 +3,262 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Arg-TCT - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - C + + C - - G + + G - - C + + C - - C + + C - - C + + C - - U + + U - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - G + + G - - A + + A - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - A + + A - - C + + C - - G + + G - - A + + A - - C + + C - - C + + C - - U + + U - - U + + U - - C + + C - - U + + U - - A + + A - - A + + A - - G + + G - - U + + U - - C + + C - - G + + G - - U + + U - - G + + G - - G + + G - - G + + G - - C + + C - - C + + C - - G + + G - - C + + C - - A + + A - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - A + + A - - U + + U - - C + + C - - C + + C - - U + + U - - G + + G - - C + + C - - A + + A - - G + + G - - G + + G - - G + + G - - C + + C - - G + + G - - C + + C - - G + + G - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.json index fb8363b..7253b98 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.json @@ -2,589 +2,589 @@ "nucleotides": [ { "base": "U", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "C", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "C", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "U", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "C", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "U", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "G", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "U", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "U", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "C", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 18 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 19 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 20 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 21 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 22 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 23 }, { "base": "A", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 24 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 25 }, { "base": "G", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 26 }, { "base": "G", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 27 }, { "base": "C", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 28 }, { "base": "G", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 29 }, { "base": "G", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 30 }, { "base": "A", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 31 }, { "base": "C", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 32 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 33 }, { "base": "G", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 34 }, { "base": "U", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 35 }, { "base": "U", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 36 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 37 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 38 }, { "base": "U", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 39 }, { "base": "C", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 40 }, { "base": "C", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 41 }, { "base": "G", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 42 }, { "base": "U", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 43 }, { "base": "A", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 44 }, { "base": "U", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 45 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 46 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 47 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 48 }, { "base": "A", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 49 }, { "base": "C", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 50 }, { "base": "U", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 51 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 53 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 54 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 55 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 56 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 57 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 58 }, { "base": "G", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 59 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 60 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 61 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 62 }, { "base": "A", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 63 }, { "base": "G", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 64 }, { "base": "U", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 65 }, { "base": "C", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 66 }, { "base": "A", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 67 }, { "base": "G", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 68 }, { "base": "A", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 69 }, { "base": "G", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 70 }, { "base": "G", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 71 }, { "base": "A", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 72 }, { "base": "G", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 73 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 75 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 76 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Asn-GTT", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.svg index 91bb782..795dafa 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asn-GTT.svg @@ -3,259 +3,259 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Asn-GTT - - - - - - - - - - - - - - - - - - - - - - - U + + + + + + + + + + + + + + + + + + + + + + + U - - C + + C - - C + + C - - U + + U - - C + + C - - U + + U - - G + + G - - U + + U - - A + + A - - G + + G - - U + + U - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - A + + A - - C + + C - - G + + G - - G + + G - - C + + C - - G + + G - - G + + G - - A + + A - - C + + C - - U + + U - - G + + G - - U + + U - - U + + U - - A + + A - - A + + A - - U + + U - - C + + C - - C + + C - - G + + G - - U + + U - - A + + A - - U + + U - - G + + G - - U + + U - - C + + C - - A + + A - - C + + C - - U + + U - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - G + + G - - U + + U - - C + + C - - C + + C - - A + + A - - G + + G - - U + + U - - C + + C - - A + + A - - G + + G - - A + + A - - G + + G - - G + + G - - A + + A - - G + + G - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.json index 539a449..96b7d19 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.json @@ -2,595 +2,595 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "G", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "A", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "G", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "C", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "G", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "G", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "U", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "U", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "C", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 18 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 19 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 20 }, { "base": "U", - "x": 124.03, - "y": 98.79, + "x": 151.04, + "y": 139.69, "pos": 21 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 22 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 23 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 24 }, { "base": "A", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 25 }, { "base": "U", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 26 }, { "base": "A", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 27 }, { "base": "C", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 28 }, { "base": "C", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 29 }, { "base": "U", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 30 }, { "base": "G", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 31 }, { "base": "C", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 32 }, { "base": "C", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 33 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 34 }, { "base": "G", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 35 }, { "base": "U", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 36 }, { "base": "C", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 37 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 38 }, { "base": "C", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 39 }, { "base": "G", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 40 }, { "base": "C", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 41 }, { "base": "A", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 42 }, { "base": "G", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 43 }, { "base": "G", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 44 }, { "base": "G", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 45 }, { "base": "G", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 46 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 47 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 48 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 49 }, { "base": "G", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 50 }, { "base": "C", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 51 }, { "base": "G", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 53 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 54 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 55 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 56 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 57 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 58 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 59 }, { "base": "G", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 60 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 61 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 62 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 63 }, { "base": "C", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 64 }, { "base": "G", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 65 }, { "base": "U", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 66 }, { "base": "C", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 67 }, { "base": "C", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 68 }, { "base": "G", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 69 }, { "base": "U", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 70 }, { "base": "U", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 71 }, { "base": "C", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 72 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 73 }, { "base": "G", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 75 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 76 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 77 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Asp-GTC", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.svg index 9690d57..ecc2012 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Asp-GTC.svg @@ -3,262 +3,262 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Asp-GTC - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - G + + G - - A + + A - - G + + G - - C + + C - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - U + + U - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - U + + U - - U + + U - - A + + A - - G + + G - - A + + A - - A + + A - - U + + U - - A + + A - - C + + C - - C + + C - - U + + U - - G + + G - - C + + C - - C + + C - - U + + U - - G + + G - - U + + U - - C + + C - - A + + A - - C + + C - - G + + G - - C + + C - - A + + A - - G + + G - - G + + G - - G + + G - - G + + G - - G + + G - - U + + U - - C + + C - - G + + G - - C + + C - - G + + G - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - G + + G - - U + + U - - C + + C - - C + + C - - C + + C - - G + + G - - U + + U - - C + + C - - C + + C - - G + + G - - U + + U - - U + + U - - C + + C - - C + + C - - G + + G - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.json index 98e730a..2388a20 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.json @@ -2,577 +2,577 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "G", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "C", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "G", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "C", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "G", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "U", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "A", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "A", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "A", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "C", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 18 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 19 }, { "base": "U", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 20 }, { "base": "A", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 21 }, { "base": "U", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 22 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 23 }, { "base": "U", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 24 }, { "base": "A", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 25 }, { "base": "G", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 26 }, { "base": "C", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 27 }, { "base": "G", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 28 }, { "base": "G", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 29 }, { "base": "A", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 30 }, { "base": "U", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 31 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 32 }, { "base": "G", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 33 }, { "base": "C", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 34 }, { "base": "A", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 35 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 36 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 37 }, { "base": "U", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 38 }, { "base": "C", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 39 }, { "base": "C", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 40 }, { "base": "G", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 41 }, { "base": "U", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 42 }, { "base": "C", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 43 }, { "base": "U", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 44 }, { "base": "A", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 45 }, { "base": "G", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 46 }, { "base": "U", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 47 }, { "base": "C", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 48 }, { "base": "C", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 49 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 50 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 51 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 52 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 53 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 54 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 55 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 56 }, { "base": "C", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 57 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 58 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 59 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 60 }, { "base": "G", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 61 }, { "base": "G", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 62 }, { "base": "A", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 63 }, { "base": "A", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 64 }, { "base": "C", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 65 }, { "base": "G", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 66 }, { "base": "C", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 67 }, { "base": "G", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 68 }, { "base": "C", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 69 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 70 }, { "base": "U", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 71 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 72 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 73 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 74 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Cys-GCA", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.svg index 0e2071f..4df4e16 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Cys-GCA.svg @@ -3,253 +3,253 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Cys-GCA - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - G + + G - - C + + C - - G + + G - - C + + C - - G + + G - - U + + U - - U + + U - - A + + A - - A + + A - - C + + C - - A + + A - - A + + A - - A + + A - - G + + G - - C + + C - - G + + G - - G + + G - - U + + U - - U + + U - - A + + A - - U + + U - - G + + G - - U + + U - - A + + A - - G + + G - - C + + C - - G + + G - - G + + G - - A + + A - - U + + U - - U + + U - - G + + G - - C + + C - - A + + A - - A + + A - - A + + A - - U + + U - - C + + C - - C + + C - - G + + G - - U + + U - - C + + C - - U + + U - - A + + A - - G + + G - - U + + U - - C + + C - - C + + C - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - C + + C - - U + + U - - C + + C - - C + + C - - G + + G - - G + + G - - A + + A - - A + + A - - C + + C - - G + + G - - C + + C - - G + + G - - C + + C - - C + + C - - U + + U - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.json index cdc4d37..0df8f73 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.json @@ -2,583 +2,583 @@ "nucleotides": [ { "base": "U", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "G", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "G", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "G", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "G", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "U", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "A", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "C", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "C", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "A", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "C", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 18 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 19 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 20 }, { "base": "A", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 21 }, { "base": "G", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 22 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 23 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 24 }, { "base": "A", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 25 }, { "base": "C", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 26 }, { "base": "C", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 27 }, { "base": "G", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 28 }, { "base": "G", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 29 }, { "base": "A", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 30 }, { "base": "U", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 31 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 32 }, { "base": "C", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 33 }, { "base": "U", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 34 }, { "base": "G", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 35 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 36 }, { "base": "U", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 37 }, { "base": "U", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 38 }, { "base": "C", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 39 }, { "base": "C", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 40 }, { "base": "G", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 41 }, { "base": "G", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 42 }, { "base": "C", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 43 }, { "base": "A", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 44 }, { "base": "U", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 45 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 46 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 47 }, { "base": "C", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 48 }, { "base": "G", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 49 }, { "base": "A", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 50 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 51 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 52 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 53 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 54 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 55 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 56 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 57 }, { "base": "A", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 58 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 59 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 60 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 61 }, { "base": "U", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 62 }, { "base": "C", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 63 }, { "base": "G", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 64 }, { "base": "U", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 65 }, { "base": "A", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 66 }, { "base": "C", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 67 }, { "base": "C", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 68 }, { "base": "C", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 69 }, { "base": "C", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 70 }, { "base": "A", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 71 }, { "base": "G", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 72 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 73 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 74 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 75 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Gln-CTG", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.svg index 7c1f305..a93e574 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-CTG.svg @@ -3,256 +3,256 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Gln-CTG - - - - - - - - - - - - - - - - - - - - - - - U + + + + + + + + + + + + + + + + + + + + + + + U - - G + + G - - G + + G - - G + + G - - G + + G - - U + + U - - A + + A - - U + + U - - C + + C - - G + + G - - C + + C - - C + + C - - A + + A - - A + + A - - G + + G - - C + + C - - G + + G - - G + + G - - U + + U - - A + + A - - A + + A - - G + + G - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - G + + G - - G + + G - - A + + A - - U + + U - - U + + U - - C + + C - - U + + U - - G + + G - - A + + A - - U + + U - - U + + U - - C + + C - - C + + C - - G + + G - - G + + G - - C + + C - - A + + A - - U + + U - - U + + U - - C + + C - - C + + C - - G + + G - - A + + A - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - A + + A - - U + + U - - C + + C - - C + + C - - U + + U - - C + + C - - G + + G - - U + + U - - A + + A - - C + + C - - C + + C - - C + + C - - C + + C - - A + + A - - G + + G - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.json index e31a2ae..59ebab7 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.json @@ -2,583 +2,583 @@ "nucleotides": [ { "base": "U", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "G", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "G", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "G", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "G", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "U", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "A", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "C", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "C", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "A", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "C", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 18 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 19 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 20 }, { "base": "A", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 21 }, { "base": "G", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 22 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 23 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 24 }, { "base": "A", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 25 }, { "base": "C", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 26 }, { "base": "C", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 27 }, { "base": "G", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 28 }, { "base": "G", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 29 }, { "base": "U", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 30 }, { "base": "U", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 31 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 32 }, { "base": "U", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 33 }, { "base": "U", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 34 }, { "base": "G", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 35 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 36 }, { "base": "U", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 37 }, { "base": "A", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 38 }, { "base": "C", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 39 }, { "base": "C", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 40 }, { "base": "G", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 41 }, { "base": "G", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 42 }, { "base": "C", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 43 }, { "base": "A", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 44 }, { "base": "U", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 45 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 46 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 47 }, { "base": "C", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 48 }, { "base": "C", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 49 }, { "base": "U", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 50 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 51 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 52 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 53 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 54 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 55 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 56 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 57 }, { "base": "A", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 58 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 59 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 60 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 61 }, { "base": "A", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 62 }, { "base": "G", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 63 }, { "base": "G", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 64 }, { "base": "U", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 65 }, { "base": "A", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 66 }, { "base": "C", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 67 }, { "base": "C", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 68 }, { "base": "C", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 69 }, { "base": "C", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 70 }, { "base": "A", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 71 }, { "base": "G", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 72 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 73 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 74 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 75 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Gln-TTG", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.svg index 0db24ee..4223cb9 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gln-TTG.svg @@ -3,256 +3,256 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Gln-TTG - - - - - - - - - - - - - - - - - - - - - - - U + + + + + + + + + + + + + + + + + + + + + + + U - - G + + G - - G + + G - - G + + G - - G + + G - - U + + U - - A + + A - - U + + U - - C + + C - - G + + G - - C + + C - - C + + C - - A + + A - - A + + A - - G + + G - - C + + C - - G + + G - - G + + G - - U + + U - - A + + A - - A + + A - - G + + G - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - G + + G - - G + + G - - U + + U - - U + + U - - U + + U - - U + + U - - U + + U - - G + + G - - A + + A - - U + + U - - A + + A - - C + + C - - C + + C - - G + + G - - G + + G - - C + + C - - A + + A - - U + + U - - U + + U - - C + + C - - C + + C - - C + + C - - U + + U - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - A + + A - - U + + U - - C + + C - - C + + C - - A + + A - - G + + G - - G + + G - - U + + U - - A + + A - - C + + C - - C + + C - - C + + C - - C + + C - - A + + A - - G + + G - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.json index f408d37..6d57eff 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.json @@ -2,589 +2,589 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "U", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "C", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "C", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "C", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "C", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "U", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "C", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "U", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "C", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "U", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "A", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 18 }, { "base": "C", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 19 }, { "base": "C", - "x": 124.03, - "y": 98.79, + "x": 151.04, + "y": 139.69, "pos": 20 }, { "base": "C", - "x": 124.57, - "y": 97.55, + "x": 151.96, + "y": 137.6, "pos": 21 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 22 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 23 }, { "base": "G", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 24 }, { "base": "A", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 25 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 26 }, { "base": "A", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 27 }, { "base": "C", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 28 }, { "base": "C", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 29 }, { "base": "G", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 30 }, { "base": "C", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 31 }, { "base": "C", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 32 }, { "base": "C", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 33 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 34 }, { "base": "U", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 35 }, { "base": "U", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 36 }, { "base": "C", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 37 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 38 }, { "base": "C", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 39 }, { "base": "G", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 40 }, { "base": "G", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 41 }, { "base": "C", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 42 }, { "base": "G", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 43 }, { "base": "G", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 44 }, { "base": "U", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 45 }, { "base": "A", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 46 }, { "base": "A", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 47 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 48 }, { "base": "A", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 49 }, { "base": "G", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 50 }, { "base": "G", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 51 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 53 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 54 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 55 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 56 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 57 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 58 }, { "base": "A", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 59 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 60 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 61 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 62 }, { "base": "C", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 63 }, { "base": "C", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 64 }, { "base": "U", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 65 }, { "base": "A", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 66 }, { "base": "G", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 67 }, { "base": "G", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 68 }, { "base": "G", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 69 }, { "base": "G", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 70 }, { "base": "A", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 71 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 72 }, { "base": "G", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 73 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 75 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 76 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Glu-TTC", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.svg index e829a61..95bd6c4 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Glu-TTC.svg @@ -3,259 +3,259 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Glu-TTC - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - U + + U - - C + + C - - C + + C - - C + + C - - C + + C - - U + + U - - U + + U - - C + + C - - G + + G - - U + + U - - C + + C - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - G + + G - - C + + C - - C + + C - - C + + C - - A + + A - - G + + G - - G + + G - - A + + A - - C + + C - - A + + A - - C + + C - - C + + C - - G + + G - - C + + C - - C + + C - - C + + C - - U + + U - - U + + U - - U + + U - - C + + C - - A + + A - - C + + C - - G + + G - - G + + G - - C + + C - - G + + G - - G + + G - - U + + U - - A + + A - - A + + A - - C + + C - - A + + A - - G + + G - - G + + G - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - A + + A - - U + + U - - C + + C - - C + + C - - C + + C - - C + + C - - U + + U - - A + + A - - G + + G - - G + + G - - G + + G - - G + + G - - A + + A - - C + + C - - G + + G - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.json index 447a515..fcdb2dd 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.json @@ -2,577 +2,577 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "C", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "G", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "G", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "G", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "C", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "G", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "U", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "A", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "U", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 18 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 19 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 20 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 21 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 22 }, { "base": "A", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 23 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 24 }, { "base": "G", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 25 }, { "base": "A", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 26 }, { "base": "G", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 27 }, { "base": "A", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 28 }, { "base": "G", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 29 }, { "base": "C", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 30 }, { "base": "U", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 31 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 32 }, { "base": "C", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 33 }, { "base": "C", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 34 }, { "base": "C", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 35 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 36 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 37 }, { "base": "G", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 38 }, { "base": "C", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 39 }, { "base": "U", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 40 }, { "base": "C", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 41 }, { "base": "U", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 42 }, { "base": "A", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 43 }, { "base": "U", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 44 }, { "base": "A", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 45 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 46 }, { "base": "G", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 47 }, { "base": "A", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 48 }, { "base": "G", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 49 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 50 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 51 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 52 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 53 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 54 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 55 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 56 }, { "base": "U", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 57 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 58 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 59 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 60 }, { "base": "C", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 61 }, { "base": "U", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 62 }, { "base": "U", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 63 }, { "base": "C", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 64 }, { "base": "G", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 65 }, { "base": "C", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 66 }, { "base": "C", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 67 }, { "base": "C", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 68 }, { "base": "G", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 69 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 70 }, { "base": "U", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 71 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 72 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 73 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 74 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Gly-CCC", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.svg index 6749d7f..02dea5b 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-CCC.svg @@ -3,253 +3,253 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Gly-CCC - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - C + + C - - G + + G - - G + + G - - G + + G - - C + + C - - G + + G - - U + + U - - A + + A - - G + + G - - U + + U - - U + + U - - C + + C - - A + + A - - A + + A - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - A + + A - - C + + C - - G + + G - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - U + + U - - U + + U - - C + + C - - C + + C - - C + + C - - A + + A - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - U + + U - - A + + A - - U + + U - - A + + A - - C + + C - - G + + G - - A + + A - - G + + G - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - U + + U - - U + + U - - C + + C - - C + + C - - C + + C - - U + + U - - U + + U - - C + + C - - G + + G - - C + + C - - C + + C - - C + + C - - G + + G - - C + + C - - U + + U - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.json index fa7a35b..e17ec67 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.json @@ -2,589 +2,589 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "C", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "G", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "G", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "G", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "A", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "A", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "U", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "U", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 18 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 19 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 20 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 21 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 22 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 23 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 24 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 25 }, { "base": "A", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 26 }, { "base": "C", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 27 }, { "base": "G", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 28 }, { "base": "A", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 29 }, { "base": "C", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 30 }, { "base": "C", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 31 }, { "base": "U", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 32 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 33 }, { "base": "G", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 34 }, { "base": "C", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 35 }, { "base": "C", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 36 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 37 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 38 }, { "base": "G", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 39 }, { "base": "G", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 40 }, { "base": "U", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 41 }, { "base": "C", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 42 }, { "base": "G", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 43 }, { "base": "G", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 44 }, { "base": "G", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 45 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 46 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 47 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 48 }, { "base": "G", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 49 }, { "base": "C", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 50 }, { "base": "G", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 51 }, { "base": "A", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 53 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 54 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 55 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 56 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 57 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 58 }, { "base": "G", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 59 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 60 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 61 }, { "base": "U", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 62 }, { "base": "C", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 63 }, { "base": "G", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 64 }, { "base": "U", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 65 }, { "base": "U", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 66 }, { "base": "U", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 67 }, { "base": "C", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 68 }, { "base": "C", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 69 }, { "base": "C", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 70 }, { "base": "G", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 71 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 72 }, { "base": "U", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 73 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 75 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 76 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Gly-GCC", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.svg index f0cb786..e7f1185 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-GCC.svg @@ -3,259 +3,259 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Gly-GCC - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - C + + C - - G + + G - - G + + G - - G + + G - - A + + A - - A + + A - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - C + + C - - G + + G - - A + + A - - C + + C - - C + + C - - U + + U - - U + + U - - G + + G - - C + + C - - C + + C - - A + + A - - A + + A - - G + + G - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - G + + G - - G + + G - - U + + U - - C + + C - - G + + G - - C + + C - - G + + G - - A + + A - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - G + + G - - U + + U - - C + + C - - U + + U - - C + + C - - G + + G - - U + + U - - U + + U - - U + + U - - C + + C - - C + + C - - C + + C - - G + + G - - C + + C - - U + + U - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.json index 28f10c1..a7914fa 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.json @@ -2,583 +2,583 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "C", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "G", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "G", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "G", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "C", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "A", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "C", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "U", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "A", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "U", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "A", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "U", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 18 }, { "base": "C", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 19 }, { "base": "U", - "x": 124.03, - "y": 98.79, + "x": 151.04, + "y": 139.69, "pos": 20 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 21 }, { "base": "U", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 22 }, { "base": "U", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 23 }, { "base": "A", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 24 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 25 }, { "base": "C", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 26 }, { "base": "U", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 27 }, { "base": "C", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 28 }, { "base": "A", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 29 }, { "base": "G", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 30 }, { "base": "C", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 31 }, { "base": "C", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 32 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 33 }, { "base": "U", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 34 }, { "base": "C", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 35 }, { "base": "C", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 36 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 37 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 38 }, { "base": "G", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 39 }, { "base": "C", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 40 }, { "base": "U", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 41 }, { "base": "G", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 42 }, { "base": "A", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 43 }, { "base": "U", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 44 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 45 }, { "base": "A", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 46 }, { "base": "U", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 47 }, { "base": "G", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 48 }, { "base": "C", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 49 }, { "base": "G", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 50 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 51 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 52 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 53 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 54 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 55 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 56 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 57 }, { "base": "U", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 58 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 59 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 60 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 61 }, { "base": "C", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 62 }, { "base": "G", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 63 }, { "base": "C", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 64 }, { "base": "U", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 65 }, { "base": "G", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 66 }, { "base": "C", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 67 }, { "base": "C", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 68 }, { "base": "C", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 69 }, { "base": "G", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 70 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 71 }, { "base": "U", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 72 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 73 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 74 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 75 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Gly-TCC", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.svg index e9ef97a..5a9be55 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Gly-TCC.svg @@ -3,256 +3,256 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Gly-TCC - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - C + + C - - G + + G - - G + + G - - G + + G - - C + + C - - A + + A - - U + + U - - C + + C - - G + + G - - U + + U - - A + + A - - U + + U - - A + + A - - A + + A - - U + + U - - G + + G - - G + + G - - C + + C - - U + + U - - A + + A - - U + + U - - U + + U - - A + + A - - C + + C - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - C + + C - - C + + C - - U + + U - - U + + U - - C + + C - - C + + C - - A + + A - - A + + A - - G + + G - - C + + C - - U + + U - - G + + G - - A + + A - - U + + U - - G + + G - - A + + A - - U + + U - - G + + G - - C + + C - - G + + G - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - U + + U - - U + + U - - C + + C - - C + + C - - C + + C - - G + + G - - C + + C - - U + + U - - G + + G - - C + + C - - C + + C - - C + + C - - G + + G - - C + + C - - U + + U - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.json index 9506efb..e26a584 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.json @@ -2,589 +2,589 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "U", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "G", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "G", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "C", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "U", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "A", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "U", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "U", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 18 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 19 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 20 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 21 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 22 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 23 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 24 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 25 }, { "base": "C", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 26 }, { "base": "C", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 27 }, { "base": "U", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 28 }, { "base": "G", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 29 }, { "base": "G", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 30 }, { "base": "A", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 31 }, { "base": "U", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 32 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 33 }, { "base": "G", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 34 }, { "base": "U", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 35 }, { "base": "G", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 36 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 37 }, { "base": "U", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 38 }, { "base": "U", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 39 }, { "base": "C", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 40 }, { "base": "C", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 41 }, { "base": "A", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 42 }, { "base": "G", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 43 }, { "base": "U", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 44 }, { "base": "U", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 45 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 46 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 47 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 48 }, { "base": "G", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 49 }, { "base": "U", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 50 }, { "base": "G", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 51 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 53 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 54 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 55 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 56 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 57 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 58 }, { "base": "A", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 59 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 60 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 61 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 62 }, { "base": "C", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 63 }, { "base": "A", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 64 }, { "base": "U", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 65 }, { "base": "U", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 66 }, { "base": "A", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 67 }, { "base": "G", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 68 }, { "base": "C", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 69 }, { "base": "C", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 70 }, { "base": "A", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 71 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 72 }, { "base": "C", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 73 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 75 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 76 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-His-GTG", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.svg index a47eb36..2d1e7bc 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-His-GTG.svg @@ -3,259 +3,259 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-His-GTG - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - U + + U - - G + + G - - G + + G - - C + + C - - U + + U - - A + + A - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - C + + C - - C + + C - - U + + U - - G + + G - - G + + G - - A + + A - - U + + U - - U + + U - - G + + G - - U + + U - - G + + G - - A + + A - - U + + U - - U + + U - - C + + C - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - U + + U - - C + + C - - G + + G - - U + + U - - G + + G - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - A + + A - - U + + U - - C + + C - - C + + C - - C + + C - - A + + A - - U + + U - - U + + U - - A + + A - - G + + G - - C + + C - - C + + C - - A + + A - - C + + C - - C + + C - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.json index a79fd1a..6004cb8 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.json @@ -2,595 +2,595 @@ "nucleotides": [ { "base": "A", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "G", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "G", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "C", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "U", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "U", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "G", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "G", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "U", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 18 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 19 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 20 }, { "base": "U", - "x": 124.03, - "y": 98.79, + "x": 151.04, + "y": 139.69, "pos": 21 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 22 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 23 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 24 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 25 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 26 }, { "base": "G", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 27 }, { "base": "C", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 28 }, { "base": "A", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 29 }, { "base": "C", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 30 }, { "base": "C", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 31 }, { "base": "C", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 32 }, { "base": "C", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 33 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 34 }, { "base": "G", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 35 }, { "base": "A", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 36 }, { "base": "U", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 37 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 38 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 39 }, { "base": "G", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 40 }, { "base": "G", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 41 }, { "base": "G", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 42 }, { "base": "U", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 43 }, { "base": "G", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 44 }, { "base": "A", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 45 }, { "base": "G", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 46 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 47 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 48 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 49 }, { "base": "G", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 50 }, { "base": "G", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 51 }, { "base": "U", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 53 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 54 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 55 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 56 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 57 }, { "base": "A", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 58 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 59 }, { "base": "G", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 60 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 61 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 62 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 63 }, { "base": "A", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 64 }, { "base": "C", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 65 }, { "base": "U", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 66 }, { "base": "C", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 67 }, { "base": "A", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 68 }, { "base": "G", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 69 }, { "base": "G", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 70 }, { "base": "C", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 71 }, { "base": "C", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 72 }, { "base": "U", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 73 }, { "base": "A", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 75 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 76 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 77 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Ile-GAT", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.svg index bbf2e28..56d0970 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Ile-GAT.svg @@ -3,262 +3,262 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Ile-GAT - - - - - - - - - - - - - - - - - - - - - - - A + + + + + + + + + + + + + + + + + + + + + + + A - - G + + G - - G + + G - - C + + C - - U + + U - - U + + U - - G + + G - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - G + + G - - U + + U - - G + + G - - G + + G - - U + + U - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - C + + C - - C + + C - - U + + U - - G + + G - - A + + A - - U + + U - - A + + A - - A + + A - - G + + G - - G + + G - - G + + G - - U + + U - - G + + G - - A + + A - - G + + G - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - U + + U - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - A + + A - - A + + A - - G + + G - - U + + U - - C + + C - - C + + C - - A + + A - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - G + + G - - C + + C - - C + + C - - U + + U - - A + + A - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.json index f843769..489ab37 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.json @@ -2,589 +2,589 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "G", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "G", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "U", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "C", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "G", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "U", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "U", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "U", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 18 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 19 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 20 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 21 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 22 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 23 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 24 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 25 }, { "base": "A", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 26 }, { "base": "G", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 27 }, { "base": "U", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 28 }, { "base": "U", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 29 }, { "base": "G", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 30 }, { "base": "A", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 31 }, { "base": "C", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 32 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 33 }, { "base": "U", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 34 }, { "base": "U", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 35 }, { "base": "U", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 36 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 37 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 38 }, { "base": "U", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 39 }, { "base": "C", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 40 }, { "base": "A", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 41 }, { "base": "A", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 42 }, { "base": "U", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 43 }, { "base": "U", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 44 }, { "base": "G", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 45 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 46 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 47 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 48 }, { "base": "G", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 49 }, { "base": "C", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 50 }, { "base": "A", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 51 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 53 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 54 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 55 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 56 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 57 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 58 }, { "base": "A", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 59 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 60 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 61 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 62 }, { "base": "U", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 63 }, { "base": "G", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 64 }, { "base": "C", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 65 }, { "base": "A", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 66 }, { "base": "C", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 67 }, { "base": "G", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 68 }, { "base": "A", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 69 }, { "base": "C", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 70 }, { "base": "C", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 71 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 72 }, { "base": "A", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 73 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 75 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 76 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Lys-TTT", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.svg index 8c6f593..f3a1eed 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Lys-TTT.svg @@ -3,259 +3,259 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Lys-TTT - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - G + + G - - G + + G - - U + + U - - C + + C - - G + + G - - U + + U - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - A + + A - - C + + C - - U + + U - - U + + U - - U + + U - - U + + U - - A + + A - - A + + A - - U + + U - - C + + C - - A + + A - - A + + A - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - C + + C - - G + + G - - C + + C - - A + + A - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - A + + A - - U + + U - - C + + C - - C + + C - - U + + U - - G + + G - - C + + C - - A + + A - - C + + C - - G + + G - - A + + A - - C + + C - - C + + C - - C + + C - - A + + A - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.json index 37756f4..60efc60 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.json @@ -2,595 +2,595 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "G", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "C", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "U", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "A", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "C", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "G", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "U", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "U", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 18 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 19 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 20 }, { "base": "U", - "x": 124.03, - "y": 98.79, + "x": 151.04, + "y": 139.69, "pos": 21 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 22 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 23 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 24 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 25 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 26 }, { "base": "A", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 27 }, { "base": "C", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 28 }, { "base": "A", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 29 }, { "base": "U", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 30 }, { "base": "C", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 31 }, { "base": "A", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 32 }, { "base": "C", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 33 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 34 }, { "base": "C", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 35 }, { "base": "A", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 36 }, { "base": "U", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 37 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 38 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 39 }, { "base": "U", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 40 }, { "base": "G", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 41 }, { "base": "A", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 42 }, { "base": "U", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 43 }, { "base": "G", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 44 }, { "base": "G", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 45 }, { "base": "G", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 46 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 47 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 48 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 49 }, { "base": "A", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 50 }, { "base": "C", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 51 }, { "base": "A", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 53 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 54 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 55 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 56 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 57 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 58 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 59 }, { "base": "A", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 60 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 61 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 62 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 63 }, { "base": "C", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 64 }, { "base": "G", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 65 }, { "base": "U", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 66 }, { "base": "C", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 67 }, { "base": "G", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 68 }, { "base": "U", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 69 }, { "base": "A", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 70 }, { "base": "G", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 71 }, { "base": "C", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 72 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 73 }, { "base": "A", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 75 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 76 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 77 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Met-CAT", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.svg index b633d4f..9cca0ec 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Met-CAT.svg @@ -3,262 +3,262 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Met-CAT - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - G + + G - - C + + C - - U + + U - - A + + A - - C + + C - - G + + G - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - C + + C - - A + + A - - U + + U - - C + + C - - A + + A - - C + + C - - U + + U - - C + + C - - A + + A - - U + + U - - A + + A - - A + + A - - U + + U - - G + + G - - A + + A - - U + + U - - G + + G - - G + + G - - G + + G - - G + + G - - U + + U - - C + + C - - A + + A - - C + + C - - A + + A - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - A + + A - - U + + U - - C + + C - - C + + C - - C + + C - - G + + G - - U + + U - - C + + C - - G + + G - - U + + U - - A + + A - - G + + G - - C + + C - - C + + C - - A + + A - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.json index d5e752f..7c284f5 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.json @@ -2,589 +2,589 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "C", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "C", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "C", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "G", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "G", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "A", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "U", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "C", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 18 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 19 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 20 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 21 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 22 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 23 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 24 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 25 }, { "base": "A", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 26 }, { "base": "G", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 27 }, { "base": "G", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 28 }, { "base": "G", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 29 }, { "base": "G", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 30 }, { "base": "A", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 31 }, { "base": "U", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 32 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 33 }, { "base": "G", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 34 }, { "base": "A", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 35 }, { "base": "A", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 36 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 37 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 38 }, { "base": "U", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 39 }, { "base": "C", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 40 }, { "base": "C", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 41 }, { "base": "C", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 42 }, { "base": "C", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 43 }, { "base": "G", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 44 }, { "base": "U", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 45 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 46 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 47 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 48 }, { "base": "C", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 49 }, { "base": "U", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 50 }, { "base": "U", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 51 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 53 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 54 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 55 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 56 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 57 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 58 }, { "base": "U", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 59 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 60 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 61 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 62 }, { "base": "G", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 63 }, { "base": "A", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 64 }, { "base": "G", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 65 }, { "base": "U", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 66 }, { "base": "C", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 67 }, { "base": "C", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 68 }, { "base": "G", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 69 }, { "base": "G", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 70 }, { "base": "G", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 71 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 72 }, { "base": "A", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 73 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 75 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 76 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Phe-GAA", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.svg index f4ae6df..b7595be 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Phe-GAA.svg @@ -3,259 +3,259 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Phe-GAA - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - C + + C - - C + + C - - C + + C - - G + + G - - G + + G - - A + + A - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - G + + G - - G + + G - - G + + G - - G + + G - - A + + A - - U + + U - - U + + U - - G + + G - - A + + A - - A + + A - - A + + A - - A + + A - - U + + U - - C + + C - - C + + C - - C + + C - - C + + C - - G + + G - - U + + U - - G + + G - - U + + U - - C + + C - - C + + C - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - U + + U - - U + + U - - C + + C - - C + + C - - G + + G - - A + + A - - G + + G - - U + + U - - C + + C - - C + + C - - G + + G - - G + + G - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.json index 38a6d0f..6309350 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.json @@ -2,595 +2,595 @@ "nucleotides": [ { "base": "C", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "G", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "G", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "U", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "G", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "A", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "U", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "G", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "G", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "C", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "C", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "U", - "x": 113.78, - "y": 105.07, + "x": 133.78, + "y": 150.27, "pos": 18 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 19 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 20 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 21 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 22 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 23 }, { "base": "C", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 24 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 25 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 26 }, { "base": "A", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 27 }, { "base": "C", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 28 }, { "base": "U", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 29 }, { "base": "U", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 30 }, { "base": "C", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 31 }, { "base": "G", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 32 }, { "base": "U", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 33 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 34 }, { "base": "C", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 35 }, { "base": "G", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 36 }, { "base": "G", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 37 }, { "base": "G", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 38 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 39 }, { "base": "C", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 40 }, { "base": "G", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 41 }, { "base": "A", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 42 }, { "base": "A", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 43 }, { "base": "G", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 44 }, { "base": "G", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 45 }, { "base": "G", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 46 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 47 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 48 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 49 }, { "base": "G", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 50 }, { "base": "G", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 51 }, { "base": "A", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 53 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 54 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 55 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 56 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 57 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 58 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 59 }, { "base": "A", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 60 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 61 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 62 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 63 }, { "base": "U", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 64 }, { "base": "C", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 65 }, { "base": "U", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 66 }, { "base": "A", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 67 }, { "base": "U", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 68 }, { "base": "C", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 69 }, { "base": "A", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 70 }, { "base": "C", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 71 }, { "base": "C", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 72 }, { "base": "G", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 73 }, { "base": "A", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 75 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 76 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 77 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Pro-CGG", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.svg index c84c8c2..4be4727 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-CGG.svg @@ -3,262 +3,262 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Pro-CGG - - - - - - - - - - - - - - - - - - - - - - - C + + + + + + + + + + + + + + + + + + + + + + + C - - G + + G - - G + + G - - U + + U - - G + + G - - A + + A - - U + + U - - U + + U - - G + + G - - G + + G - - C + + C - - G + + G - - C + + C - - A + + A - - G + + G - - C + + C - - C + + C - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - A + + A - - C + + C - - U + + U - - U + + U - - C + + C - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - G + + G - - G + + G - - A + + A - - C + + C - - G + + G - - A + + A - - A + + A - - G + + G - - G + + G - - G + + G - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - A + + A - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - A + + A - - U + + U - - C + + C - - C + + C - - U + + U - - C + + C - - U + + U - - A + + A - - U + + U - - C + + C - - A + + A - - C + + C - - C + + C - - G + + G - - A + + A - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.json index 00f02a0..f991397 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.json @@ -2,595 +2,595 @@ "nucleotides": [ { "base": "C", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "G", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "G", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "C", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "A", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "C", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "G", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "G", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "C", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "C", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "U", - "x": 113.78, - "y": 105.07, + "x": 133.78, + "y": 150.27, "pos": 18 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 19 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 20 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 21 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 22 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 23 }, { "base": "C", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 24 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 25 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 26 }, { "base": "A", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 27 }, { "base": "C", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 28 }, { "base": "C", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 29 }, { "base": "G", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 30 }, { "base": "U", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 31 }, { "base": "C", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 32 }, { "base": "A", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 33 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 34 }, { "base": "G", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 35 }, { "base": "G", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 36 }, { "base": "G", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 37 }, { "base": "G", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 38 }, { "base": "U", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 39 }, { "base": "G", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 40 }, { "base": "U", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 41 }, { "base": "C", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 42 }, { "base": "G", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 43 }, { "base": "G", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 44 }, { "base": "G", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 45 }, { "base": "G", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 46 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 47 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 48 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 49 }, { "base": "G", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 50 }, { "base": "G", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 51 }, { "base": "A", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 53 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 54 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 55 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 56 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 57 }, { "base": "A", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 58 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 59 }, { "base": "A", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 60 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 61 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 62 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 63 }, { "base": "U", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 64 }, { "base": "C", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 65 }, { "base": "U", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 66 }, { "base": "C", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 67 }, { "base": "G", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 68 }, { "base": "U", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 69 }, { "base": "G", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 70 }, { "base": "C", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 71 }, { "base": "C", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 72 }, { "base": "G", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 73 }, { "base": "A", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 75 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 76 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 77 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Pro-GGG", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.svg index 29f6565..18089b5 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-GGG.svg @@ -3,262 +3,262 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Pro-GGG - - - - - - - - - - - - - - - - - - - - - - - C + + + + + + + + + + + + + + + + + + + + + + + C - - G + + G - - G + + G - - C + + C - - A + + A - - C + + C - - G + + G - - U + + U - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - A + + A - - G + + G - - C + + C - - C + + C - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - G + + G - - U + + U - - C + + C - - A + + A - - U + + U - - G + + G - - G + + G - - G + + G - - G + + G - - U + + U - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - G + + G - - G + + G - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - A + + A - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - A + + A - - A + + A - - A + + A - - U + + U - - C + + C - - C + + C - - U + + U - - C + + C - - U + + U - - C + + C - - G + + G - - U + + U - - G + + G - - C + + C - - C + + C - - G + + G - - A + + A - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.json index a01af03..0b1a96a 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.json @@ -2,595 +2,595 @@ "nucleotides": [ { "base": "C", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "G", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "G", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "C", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "G", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "A", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "G", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "G", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "C", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "U", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "U", - "x": 113.78, - "y": 105.07, + "x": 133.78, + "y": 150.27, "pos": 18 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 19 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 20 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 21 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 22 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 23 }, { "base": "C", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 24 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 25 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 26 }, { "base": "A", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 27 }, { "base": "A", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 28 }, { "base": "C", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 29 }, { "base": "U", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 30 }, { "base": "G", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 31 }, { "base": "G", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 32 }, { "base": "U", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 33 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 34 }, { "base": "U", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 35 }, { "base": "G", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 36 }, { "base": "G", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 37 }, { "base": "G", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 38 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 39 }, { "base": "C", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 40 }, { "base": "C", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 41 }, { "base": "A", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 42 }, { "base": "G", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 43 }, { "base": "U", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 44 }, { "base": "G", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 45 }, { "base": "G", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 46 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 47 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 48 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 49 }, { "base": "G", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 50 }, { "base": "G", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 51 }, { "base": "A", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 53 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 54 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 55 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 56 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 57 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 58 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 59 }, { "base": "A", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 60 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 61 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 62 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 63 }, { "base": "U", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 64 }, { "base": "C", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 65 }, { "base": "U", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 66 }, { "base": "C", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 67 }, { "base": "U", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 68 }, { "base": "C", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 69 }, { "base": "G", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 70 }, { "base": "C", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 71 }, { "base": "C", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 72 }, { "base": "G", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 73 }, { "base": "A", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 75 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 76 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 77 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Pro-TGG", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.svg index fde6d58..2532eb7 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Pro-TGG.svg @@ -3,262 +3,262 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Pro-TGG - - - - - - - - - - - - - - - - - - - - - - - C + + + + + + + + + + + + + + + + + + + + + + + C - - G + + G - - G + + G - - C + + C - - G + + G - - A + + A - - G + + G - - U + + U - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - A + + A - - G + + G - - C + + C - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - A + + A - - A + + A - - C + + C - - U + + U - - G + + G - - G + + G - - U + + U - - U + + U - - U + + U - - G + + G - - G + + G - - G + + G - - A + + A - - C + + C - - C + + C - - A + + A - - G + + G - - U + + U - - G + + G - - G + + G - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - A + + A - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - A + + A - - U + + U - - C + + C - - C + + C - - U + + U - - C + + C - - U + + U - - C + + C - - U + + U - - C + + C - - G + + G - - C + + C - - C + + C - - G + + G - - A + + A - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.json index 1c9859f..c8c6e96 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.json @@ -2,589 +2,589 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "C", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "C", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "G", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "A", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "U", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "A", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "U", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "U", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 18 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 19 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 20 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 21 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 22 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 23 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 24 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 25 }, { "base": "A", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 26 }, { "base": "G", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 27 }, { "base": "C", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 28 }, { "base": "G", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 29 }, { "base": "C", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 30 }, { "base": "A", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 31 }, { "base": "U", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 32 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 33 }, { "base": "C", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 34 }, { "base": "G", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 35 }, { "base": "U", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 36 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 37 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 38 }, { "base": "U", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 39 }, { "base": "G", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 40 }, { "base": "C", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 41 }, { "base": "G", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 42 }, { "base": "A", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 43 }, { "base": "A", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 44 }, { "base": "G", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 45 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 46 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 47 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 48 }, { "base": "G", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 49 }, { "base": "U", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 50 }, { "base": "A", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 51 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 53 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 54 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 55 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 56 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 57 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 58 }, { "base": "C", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 59 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 60 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 61 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 62 }, { "base": "U", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 63 }, { "base": "A", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 64 }, { "base": "U", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 65 }, { "base": "U", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 66 }, { "base": "A", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 67 }, { "base": "U", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 68 }, { "base": "C", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 69 }, { "base": "G", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 70 }, { "base": "G", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 71 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 72 }, { "base": "A", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 73 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 75 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 76 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Thr-CGT", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.svg index 138b163..dc6dae6 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-CGT.svg @@ -3,259 +3,259 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Thr-CGT - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - C + + C - - C + + C - - G + + G - - A + + A - - U + + U - - A + + A - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - A + + A - - U + + U - - U + + U - - C + + C - - G + + G - - U + + U - - A + + A - - A + + A - - U + + U - - G + + G - - C + + C - - G + + G - - A + + A - - A + + A - - G + + G - - G + + G - - U + + U - - C + + C - - G + + G - - U + + U - - A + + A - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - C + + C - - U + + U - - C + + C - - C + + C - - U + + U - - A + + A - - U + + U - - U + + U - - A + + A - - U + + U - - C + + C - - G + + G - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.json index 77955f3..1ff421b 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.json @@ -2,589 +2,589 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "C", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "U", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "G", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "A", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "U", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "A", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "U", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "U", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 18 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 19 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 20 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 21 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 22 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 23 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 24 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 25 }, { "base": "G", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 26 }, { "base": "C", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 27 }, { "base": "A", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 28 }, { "base": "C", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 29 }, { "base": "C", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 30 }, { "base": "C", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 31 }, { "base": "U", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 32 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 33 }, { "base": "G", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 34 }, { "base": "G", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 35 }, { "base": "U", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 36 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 37 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 38 }, { "base": "G", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 39 }, { "base": "G", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 40 }, { "base": "G", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 41 }, { "base": "U", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 42 }, { "base": "G", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 43 }, { "base": "A", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 44 }, { "base": "G", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 45 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 46 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 47 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 48 }, { "base": "G", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 49 }, { "base": "G", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 50 }, { "base": "C", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 51 }, { "base": "A", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 53 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 54 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 55 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 56 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 57 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 58 }, { "base": "A", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 59 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 60 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 61 }, { "base": "U", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 62 }, { "base": "G", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 63 }, { "base": "C", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 64 }, { "base": "C", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 65 }, { "base": "U", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 66 }, { "base": "A", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 67 }, { "base": "U", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 68 }, { "base": "C", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 69 }, { "base": "A", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 70 }, { "base": "G", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 71 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 72 }, { "base": "A", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 73 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 75 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 76 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Thr-GGT", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.svg index 6c6c570..5a08593 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-GGT.svg @@ -3,259 +3,259 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Thr-GGT - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - C + + C - - U + + U - - G + + G - - A + + A - - U + + U - - A + + A - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - C + + C - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - A + + A - - G + + G - - G + + G - - G + + G - - U + + U - - G + + G - - A + + A - - G + + G - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - A + + A - - U + + U - - C + + C - - U + + U - - G + + G - - C + + C - - C + + C - - U + + U - - A + + A - - U + + U - - C + + C - - A + + A - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.json index 9a04202..743baae 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.json @@ -2,589 +2,589 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "C", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "C", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "G", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "A", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "C", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "U", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "U", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "A", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 18 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 19 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 20 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 21 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 22 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 23 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 24 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 25 }, { "base": "A", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 26 }, { "base": "A", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 27 }, { "base": "C", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 28 }, { "base": "U", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 29 }, { "base": "G", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 30 }, { "base": "A", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 31 }, { "base": "C", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 32 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 33 }, { "base": "U", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 34 }, { "base": "G", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 35 }, { "base": "U", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 36 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 37 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 38 }, { "base": "U", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 39 }, { "base": "C", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 40 }, { "base": "A", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 41 }, { "base": "G", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 42 }, { "base": "U", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 43 }, { "base": "A", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 44 }, { "base": "G", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 45 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 46 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 47 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 48 }, { "base": "A", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 49 }, { "base": "C", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 50 }, { "base": "C", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 51 }, { "base": "A", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 53 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 54 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 55 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 56 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 57 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 58 }, { "base": "U", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 59 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 60 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 61 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 62 }, { "base": "G", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 63 }, { "base": "G", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 64 }, { "base": "U", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 65 }, { "base": "A", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 66 }, { "base": "G", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 67 }, { "base": "U", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 68 }, { "base": "C", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 69 }, { "base": "G", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 70 }, { "base": "G", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 71 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 72 }, { "base": "A", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 73 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 75 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 76 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Thr-TGT", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.svg index d13adeb..64ef57a 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Thr-TGT.svg @@ -3,259 +3,259 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Thr-TGT - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - C + + C - - C + + C - - G + + G - - A + + A - - C + + C - - U + + U - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - A + + A - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - A + + A - - C + + C - - U + + U - - G + + G - - A + + A - - C + + C - - U + + U - - U + + U - - G + + G - - U + + U - - A + + A - - A + + A - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - A + + A - - G + + G - - G + + G - - U + + U - - C + + C - - A + + A - - C + + C - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - U + + U - - U + + U - - C + + C - - C + + C - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.json index b6b29cf..2950180 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.json @@ -2,589 +2,589 @@ "nucleotides": [ { "base": "A", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "G", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "G", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "G", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "G", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "C", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "G", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "U", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "A", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "U", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "U", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 18 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 19 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 20 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 21 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 22 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 23 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 24 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 25 }, { "base": "A", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 26 }, { "base": "C", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 27 }, { "base": "C", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 28 }, { "base": "G", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 29 }, { "base": "G", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 30 }, { "base": "U", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 31 }, { "base": "C", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 32 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 33 }, { "base": "C", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 34 }, { "base": "C", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 35 }, { "base": "A", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 36 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 37 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 38 }, { "base": "A", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 39 }, { "base": "C", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 40 }, { "base": "C", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 41 }, { "base": "G", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 42 }, { "base": "G", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 43 }, { "base": "G", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 44 }, { "base": "U", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 45 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 46 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 47 }, { "base": "U", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 48 }, { "base": "G", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 49 }, { "base": "G", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 50 }, { "base": "G", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 51 }, { "base": "A", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 53 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 54 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 55 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 56 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 57 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 58 }, { "base": "G", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 59 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 60 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 61 }, { "base": "U", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 62 }, { "base": "C", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 63 }, { "base": "U", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 64 }, { "base": "C", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 65 }, { "base": "C", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 66 }, { "base": "G", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 67 }, { "base": "C", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 68 }, { "base": "C", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 69 }, { "base": "C", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 70 }, { "base": "C", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 71 }, { "base": "U", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 72 }, { "base": "G", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 73 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 75 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 76 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Trp-CCA", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.svg index 7cb8e1a..f1de825 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Trp-CCA.svg @@ -3,259 +3,259 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Trp-CCA - - - - - - - - - - - - - - - - - - - - - - - A + + + + + + + + + + + + + + + + + + + + + + + A - - G + + G - - G + + G - - G + + G - - G + + G - - C + + C - - G + + G - - U + + U - - A + + A - - G + + G - - U + + U - - U + + U - - C + + C - - A + + A - - A + + A - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - G + + G - - G + + G - - U + + U - - C + + C - - U + + U - - C + + C - - C + + C - - A + + A - - A + + A - - A + + A - - A + + A - - C + + C - - C + + C - - G + + G - - G + + G - - G + + G - - U + + U - - G + + G - - U + + U - - U + + U - - G + + G - - G + + G - - G + + G - - A + + A - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - G + + G - - U + + U - - C + + C - - U + + U - - C + + C - - U + + U - - C + + C - - C + + C - - G + + G - - C + + C - - C + + C - - C + + C - - C + + C - - U + + U - - G + + G - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.json index 22d7732..1264a02 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.json @@ -2,595 +2,595 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "C", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "G", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "U", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "C", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "C", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "G", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "U", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "U", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 18 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 19 }, { "base": "U", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 20 }, { "base": "U", - "x": 124.03, - "y": 98.79, + "x": 151.04, + "y": 139.69, "pos": 21 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 22 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 23 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 24 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 25 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 26 }, { "base": "A", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 27 }, { "base": "C", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 28 }, { "base": "C", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 29 }, { "base": "A", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 30 }, { "base": "C", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 31 }, { "base": "C", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 32 }, { "base": "U", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 33 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 34 }, { "base": "G", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 35 }, { "base": "A", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 36 }, { "base": "C", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 37 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 38 }, { "base": "U", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 39 }, { "base": "G", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 40 }, { "base": "G", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 41 }, { "base": "U", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 42 }, { "base": "G", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 43 }, { "base": "G", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 44 }, { "base": "G", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 45 }, { "base": "G", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 46 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 47 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 48 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 49 }, { "base": "G", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 50 }, { "base": "G", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 51 }, { "base": "U", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 53 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 54 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 55 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 56 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 57 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 58 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 59 }, { "base": "G", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 60 }, { "base": "U", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 61 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 62 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 63 }, { "base": "A", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 64 }, { "base": "C", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 65 }, { "base": "U", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 66 }, { "base": "C", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 67 }, { "base": "G", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 68 }, { "base": "G", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 69 }, { "base": "A", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 70 }, { "base": "C", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 71 }, { "base": "G", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 72 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 73 }, { "base": "A", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 75 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 76 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 77 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Val-GAC", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.svg index 1b94d14..bbcf159 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-GAC.svg @@ -3,262 +3,262 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Val-GAC - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - C + + C - - G + + G - - U + + U - - C + + C - - C + + C - - G + + G - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - U + + U - - U + + U - - G + + G - - G + + G - - U + + U - - U + + U - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - A + + A - - C + + C - - C + + C - - U + + U - - U + + U - - G + + G - - A + + A - - C + + C - - A + + A - - U + + U - - G + + G - - G + + G - - U + + U - - G + + G - - G + + G - - G + + G - - G + + G - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - U + + U - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - G + + G - - U + + U - - C + + C - - C + + C - - A + + A - - C + + C - - U + + U - - C + + C - - G + + G - - G + + G - - A + + A - - C + + C - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - A + + A diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.json b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.json index 969c874..216ff5d 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.json +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.json @@ -2,589 +2,589 @@ "nucleotides": [ { "base": "G", - "x": 195.0, - "y": 42.56, + "x": 220.0, + "y": 47.56, "pos": 1 }, { "base": "G", - "x": 187.44, - "y": 42.56, + "x": 212.44, + "y": 47.56, "pos": 2 }, { "base": "G", - "x": 179.88, - "y": 42.56, + "x": 204.88, + "y": 47.56, "pos": 3 }, { "base": "U", - "x": 172.32, - "y": 42.56, + "x": 197.32, + "y": 47.56, "pos": 4 }, { "base": "G", - "x": 164.76, - "y": 42.56, + "x": 189.76, + "y": 47.56, "pos": 5 }, { "base": "A", - "x": 157.2, - "y": 42.56, + "x": 182.2, + "y": 47.56, "pos": 6 }, { "base": "U", - "x": 149.64, - "y": 42.56, + "x": 174.64, + "y": 47.56, "pos": 7 }, { "base": "U", - "x": 135.77, - "y": 51.36, + "x": 159.76, + "y": 64.23, "pos": 8 }, { "base": "A", - "x": 121.89, - "y": 60.16, + "x": 144.88, + "y": 80.89, "pos": 9 }, { "base": "G", - "x": 110.0, - "y": 64.56, + "x": 130.0, + "y": 97.56, "pos": 10 }, { "base": "C", - "x": 110.0, - "y": 72.12, + "x": 130.0, + "y": 105.12, "pos": 11 }, { "base": "U", - "x": 110.0, - "y": 79.68, + "x": 130.0, + "y": 112.68, "pos": 12 }, { "base": "C", - "x": 110.0, - "y": 87.24, + "x": 130.0, + "y": 120.24, "pos": 13 }, { "base": "A", - "x": 102.5, - "y": 95.81, + "x": 114.78, + "y": 134.68, "pos": 14 }, { "base": "G", - "x": 104.22, - "y": 99.95, + "x": 117.67, + "y": 141.66, "pos": 15 }, { "base": "C", - "x": 107.39, - "y": 103.13, + "x": 123.02, + "y": 147.01, "pos": 16 }, { "base": "U", - "x": 111.54, - "y": 104.84, + "x": 130.0, + "y": 149.9, "pos": 17 }, { "base": "G", - "x": 116.02, - "y": 104.84, + "x": 137.56, + "y": 149.9, "pos": 18 }, { "base": "G", - "x": 120.17, - "y": 103.13, + "x": 144.54, + "y": 147.01, "pos": 19 }, { "base": "G", - "x": 123.34, - "y": 99.95, + "x": 149.89, + "y": 141.66, "pos": 20 }, { "base": "A", - "x": 125.06, - "y": 95.81, + "x": 152.78, + "y": 134.68, "pos": 21 }, { "base": "G", - "x": 117.56, - "y": 87.24, + "x": 137.56, + "y": 120.24, "pos": 22 }, { "base": "A", - "x": 117.56, - "y": 79.68, + "x": 137.56, + "y": 112.68, "pos": 23 }, { "base": "G", - "x": 117.56, - "y": 72.12, + "x": 137.56, + "y": 105.12, "pos": 24 }, { "base": "C", - "x": 117.56, - "y": 64.56, + "x": 137.56, + "y": 97.56, "pos": 25 }, { "base": "A", - "x": 127.78, - "y": 62.06, + "x": 147.78, + "y": 95.06, "pos": 26 }, { "base": "C", - "x": 138.0, - "y": 64.56, + "x": 158.0, + "y": 97.56, "pos": 27 }, { "base": "C", - "x": 138.0, - "y": 72.12, + "x": 158.0, + "y": 105.12, "pos": 28 }, { "base": "U", - "x": 138.0, - "y": 79.68, + "x": 158.0, + "y": 112.68, "pos": 29 }, { "base": "C", - "x": 138.0, - "y": 87.24, + "x": 158.0, + "y": 120.24, "pos": 30 }, { "base": "C", - "x": 138.0, - "y": 94.8, + "x": 158.0, + "y": 127.8, "pos": 31 }, { "base": "C", - "x": 129.11, - "y": 102.24, + "x": 145.22, + "y": 137.53, "pos": 32 }, { "base": "U", - "x": 131.62, - "y": 107.46, + "x": 148.5, + "y": 144.34, "pos": 33 }, { "base": "U", - "x": 136.14, - "y": 111.06, + "x": 154.41, + "y": 149.05, "pos": 34 }, { "base": "A", - "x": 141.78, - "y": 112.35, + "x": 161.78, + "y": 150.73, "pos": 35 }, { "base": "C", - "x": 147.42, - "y": 111.06, + "x": 169.15, + "y": 149.05, "pos": 36 }, { "base": "A", - "x": 151.94, - "y": 107.46, + "x": 175.06, + "y": 144.34, "pos": 37 }, { "base": "A", - "x": 154.45, - "y": 102.24, + "x": 178.34, + "y": 137.53, "pos": 38 }, { "base": "G", - "x": 145.56, - "y": 94.8, + "x": 165.56, + "y": 127.8, "pos": 39 }, { "base": "G", - "x": 145.56, - "y": 87.24, + "x": 165.56, + "y": 120.24, "pos": 40 }, { "base": "A", - "x": 145.56, - "y": 79.68, + "x": 165.56, + "y": 112.68, "pos": 41 }, { "base": "G", - "x": 145.56, - "y": 72.12, + "x": 165.56, + "y": 105.12, "pos": 42 }, { "base": "G", - "x": 145.56, - "y": 64.56, + "x": 165.56, + "y": 97.56, "pos": 43 }, { "base": "G", - "x": 149.43, - "y": 58.05, + "x": 170.13, + "y": 86.9, "pos": 44 }, { "base": "G", - "x": 154.01, - "y": 55.62, + "x": 173.31, + "y": 79.96, "pos": 45 }, { "base": "G", - "x": 154.37, - "y": 53.18, + "x": 174.37, + "y": 72.42, "pos": 46 }, { "base": "U", - "x": 150.5, - "y": 50.75, + "x": 172.96, + "y": 64.93, "pos": 47 }, { "base": "C", - "x": 142.41, - "y": 48.31, + "x": 169.53, + "y": 58.11, "pos": 48 }, { "base": "G", - "x": 139.06, - "y": 42.56, + "x": 162.54, + "y": 47.56, "pos": 49 }, { "base": "G", - "x": 131.5, - "y": 42.56, + "x": 154.98, + "y": 47.56, "pos": 50 }, { "base": "C", - "x": 123.94, - "y": 42.56, + "x": 147.42, + "y": 47.56, "pos": 51 }, { "base": "G", - "x": 116.38, - "y": 42.56, + "x": 139.86, + "y": 47.56, "pos": 52 }, { "base": "G", - "x": 108.82, - "y": 42.56, + "x": 132.3, + "y": 47.56, "pos": 53 }, { "base": "U", - "x": 101.37, - "y": 51.45, + "x": 122.58, + "y": 60.34, "pos": 54 }, { "base": "U", - "x": 96.16, - "y": 48.94, + "x": 115.77, + "y": 57.06, "pos": 55 }, { "base": "C", - "x": 92.55, - "y": 44.42, + "x": 111.05, + "y": 51.15, "pos": 56 }, { "base": "G", - "x": 91.27, - "y": 38.78, + "x": 109.37, + "y": 43.78, "pos": 57 }, { "base": "A", - "x": 92.55, - "y": 33.14, + "x": 111.05, + "y": 36.41, "pos": 58 }, { "base": "U", - "x": 96.16, - "y": 28.62, + "x": 115.77, + "y": 30.5, "pos": 59 }, { "base": "C", - "x": 101.37, - "y": 26.11, + "x": 122.58, + "y": 27.22, "pos": 60 }, { "base": "C", - "x": 108.82, - "y": 35.0, + "x": 132.3, + "y": 40.0, "pos": 61 }, { "base": "C", - "x": 116.38, - "y": 35.0, + "x": 139.86, + "y": 40.0, "pos": 62 }, { "base": "G", - "x": 123.94, - "y": 35.0, + "x": 147.42, + "y": 40.0, "pos": 63 }, { "base": "U", - "x": 131.5, - "y": 35.0, + "x": 154.98, + "y": 40.0, "pos": 64 }, { "base": "C", - "x": 139.06, - "y": 35.0, + "x": 162.54, + "y": 40.0, "pos": 65 }, { "base": "A", - "x": 149.64, - "y": 35.0, + "x": 174.64, + "y": 40.0, "pos": 66 }, { "base": "U", - "x": 157.2, - "y": 35.0, + "x": 182.2, + "y": 40.0, "pos": 67 }, { "base": "C", - "x": 164.76, - "y": 35.0, + "x": 189.76, + "y": 40.0, "pos": 68 }, { "base": "A", - "x": 172.32, - "y": 35.0, + "x": 197.32, + "y": 40.0, "pos": 69 }, { "base": "C", - "x": 179.88, - "y": 35.0, + "x": 204.88, + "y": 40.0, "pos": 70 }, { "base": "C", - "x": 187.44, - "y": 35.0, + "x": 212.44, + "y": 40.0, "pos": 71 }, { "base": "C", - "x": 195.0, - "y": 35.0, + "x": 220.0, + "y": 40.0, "pos": 72 }, { "base": "A", - "x": 195.0, - "y": 27.44, + "x": 220.0, + "y": 32.44, "pos": 73 }, { "base": "C", - "x": 195.0, - "y": 19.88, + "x": 220.0, + "y": 24.88, "pos": 74 }, { "base": "C", - "x": 195.0, - "y": 12.32, + "x": 220.0, + "y": 17.32, "pos": 75 }, { "base": "A", - "x": 195.0, - "y": 4.76, + "x": 220.0, + "y": 9.76, "pos": 76 } ], - "width": 215.0, - "height": 132.35, + "width": 240.0, + "height": 170.73, "lines": [ { - "x1": 197.38, - "y1": 37.5, - "x2": 197.38, - "y2": 34.94 + "x1": 222.38, + "y1": 42.5, + "x2": 222.38, + "y2": 39.94 }, { - "x1": 189.81, - "y1": 37.5, - "x2": 189.81, - "y2": 34.94 + "x1": 214.81, + "y1": 42.5, + "x2": 214.81, + "y2": 39.94 }, { - "x1": 182.25, - "y1": 37.5, - "x2": 182.25, - "y2": 34.94 + "x1": 207.25, + "y1": 42.5, + "x2": 207.25, + "y2": 39.94 }, { - "x1": 174.69, - "y1": 37.5, - "x2": 174.69, - "y2": 34.94 + "x1": 199.69, + "y1": 42.5, + "x2": 199.69, + "y2": 39.94 }, { - "x1": 167.13, - "y1": 37.5, - "x2": 167.13, - "y2": 34.94 + "x1": 192.13, + "y1": 42.5, + "x2": 192.13, + "y2": 39.94 }, { - "x1": 159.57, - "y1": 37.5, - "x2": 159.57, - "y2": 34.94 + "x1": 184.57, + "y1": 42.5, + "x2": 184.57, + "y2": 39.94 }, { - "x1": 152.01, - "y1": 37.5, - "x2": 152.01, - "y2": 34.94 + "x1": 177.01, + "y1": 42.5, + "x2": 177.01, + "y2": 39.94 }, { - "x1": 114.88, - "y1": 62.0, - "x2": 117.44, - "y2": 62.0 + "x1": 134.88, + "y1": 95.0, + "x2": 137.44, + "y2": 95.0 }, { - "x1": 114.88, - "y1": 69.56, - "x2": 117.44, - "y2": 69.56 + "x1": 134.88, + "y1": 102.56, + "x2": 137.44, + "y2": 102.56 }, { - "x1": 114.88, - "y1": 77.12, - "x2": 117.44, - "y2": 77.12 + "x1": 134.88, + "y1": 110.12, + "x2": 137.44, + "y2": 110.12 }, { - "x1": 114.88, - "y1": 84.68, - "x2": 117.44, - "y2": 84.68 + "x1": 134.88, + "y1": 117.68, + "x2": 137.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 62.0, - "x2": 145.44, - "y2": 62.0 + "x1": 162.88, + "y1": 95.0, + "x2": 165.44, + "y2": 95.0 }, { - "x1": 142.88, - "y1": 69.56, - "x2": 145.44, - "y2": 69.56 + "x1": 162.88, + "y1": 102.56, + "x2": 165.44, + "y2": 102.56 }, { - "x1": 142.88, - "y1": 77.12, - "x2": 145.44, - "y2": 77.12 + "x1": 162.88, + "y1": 110.12, + "x2": 165.44, + "y2": 110.12 }, { - "x1": 142.88, - "y1": 84.68, - "x2": 145.44, - "y2": 84.68 + "x1": 162.88, + "y1": 117.68, + "x2": 165.44, + "y2": 117.68 }, { - "x1": 142.88, - "y1": 92.23, - "x2": 145.44, - "y2": 92.23 + "x1": 162.88, + "y1": 125.23, + "x2": 165.44, + "y2": 125.23 }, { - "x1": 141.43, - "y1": 37.5, - "x2": 141.43, - "y2": 34.94 + "x1": 164.92, + "y1": 42.5, + "x2": 164.92, + "y2": 39.94 }, { - "x1": 133.87, - "y1": 37.5, - "x2": 133.87, - "y2": 34.94 + "x1": 157.36, + "y1": 42.5, + "x2": 157.36, + "y2": 39.94 }, { - "x1": 126.31, - "y1": 37.5, - "x2": 126.31, - "y2": 34.94 + "x1": 149.8, + "y1": 42.5, + "x2": 149.8, + "y2": 39.94 }, { - "x1": 118.75, - "y1": 37.5, - "x2": 118.75, - "y2": 34.94 + "x1": 142.24, + "y1": 42.5, + "x2": 142.24, + "y2": 39.94 }, { - "x1": 111.19, - "y1": 37.5, - "x2": 111.19, - "y2": 34.94 + "x1": 134.68, + "y1": 42.5, + "x2": 134.68, + "y2": 39.94 } ], "trna_name": "tRNA-Val-TAC", diff --git a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.svg b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.svg index a4fe8b4..79d841f 100644 --- a/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.svg +++ b/inst/extdata/structures/Escherichia_coli/elbow/tRNA-Val-TAC.svg @@ -3,259 +3,259 @@ xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" - width="215.0" - height="132.35" + width="240.0" + height="170.73" xml:space="preserve"> tRNA-Val-TAC - - - - - - - - - - - - - - - - - - - - - - - G + + + + + + + + + + + + + + + + + + + + + + + G - - G + + G - - G + + G - - U + + U - - G + + G - - A + + A - - U + + U - - U + + U - - A + + A - - G + + G - - C + + C - - U + + U - - C + + C - - A + + A - - G + + G - - C + + C - - U + + U - - G + + G - - G + + G - - G + + G - - A + + A - - G + + G - - A + + A - - G + + G - - C + + C - - A + + A - - C + + C - - C + + C - - U + + U - - C + + C - - C + + C - - C + + C - - U + + U - - U + + U - - A + + A - - C + + C - - A + + A - - A + + A - - G + + G - - G + + G - - A + + A - - G + + G - - G + + G - - G + + G - - G + + G - - G + + G - - U + + U - - C + + C - - G + + G - - G + + G - - C + + C - - G + + G - - G + + G - - U + + U - - U + + U - - C + + C - - G + + G - - A + + A - - U + + U - - C + + C - - C + + C - - C + + C - - G + + G - - U + + U - - C + + C - - A + + A - - U + + U - - C + + C - - A + + A - - C + + C - - C + + C - - C + + C - - A + + A - - C + + C - - C + + C - - A + + A