We read every piece of feedback, and take your input very seriously.
To see all available qualifiers, see our documentation.
There was an error while loading. Please reload this page.
McCortex will (should) never output a graph with `dangling edges' (edges to kmers that don't exist).
mccortex31 view -q -k kmers.ctx | awk 'BEGIN{k=0}{print ">k"k; print $1; k+=1}'
Example output:
>k0 ACAGGATCTCAACCCACAGACTGCGGAGGCT >k1 AGTTCGGTAGCTCCAATCATTGCGAGGTTAG >k2 CCTTTCAGGGCGGCAAGCTACGGTTACCTGA
Get all kmers within 10 kmers of the kmers specified in kmers.to.remove.fa:
kmers.to.remove.fa
mccortex31 subgraph --out out.ctx --dist 10 --seq kmers.to.remove.fa in.ctx
Remove a set of kmers from a graph, where the kmers to remove are in the file kmers.to.remove.fa, write output to out.ctx:
out.ctx
mccortex31 subgraph --out out.ctx --invert --seq kmers.to.remove.fa in.ctx
If the kmers to remove are themselves in a graph rather than FASTA/FASTQ/BAM format, you can extract them like so:
mccortex31 view -q -k kmers.ctx | awk '{print $1}' | mccortex31 subgraph --out out.ctx --invert --seq - in.ctx
Get kmers in in.ctx that are in both a.ctx and b.ctx, write to out.ctx
in.ctx
a.ctx
b.ctx
mccortex31 join --out out.ctx --intersect a.ctx --intersect b.ctx in.ctx
Coverage/colour information from a.ctx and b.ctx will not be merged into the output file out.ctx.