#Summary Given two strings with the characters "ACGT" This program will print the longest subsequence using dynamic programming.
This program was as a homework assignment for Dr. Gerry Howser, Design and Analysis of Algorithms, Kalamazoo College.
This program was bench checked (checked with pencil and paper) for two random DNA strings of 5 to 6 characters (characters limited to "ACGT")
Finally this program was used to find the LCS (longest common subsequence) for the two strings:
S1 = ACCGGTCGAGTGCGCGGAAGCCGGCCGAA S2 = GTCGTTCGGAATGCCGTTGCTCTGTAAA.
The bench check and final results for the two strings can be verified in the JPEG images in the repository