Skip to content

senzhaocode/ScaR

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

534 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

ScaR package

Use scaffold re-aligning approach to detect the prevalence and recurrence of known fusion transcripts across samples

My image

1. Requirements (before running program)

1.1 Perl version >= 5.10.2

1.2 HiSAT2 v2.1.0 (ftp://ftp.ccb.jhu.edu/pub/infphilo/hisat2/downloads/hisat2-2.1.0-Linux_x86_64.zip)

  The binary executable files have been integrated in ~/bin/hisat2-2.1.0/, please add a working path to Linux environment variables before running: 
    PATH=$PATH:/where_is_path/ScaR/bin/hisat2-2.1.0/
    export PATH

1.3 HiSAT2 aligner HGFM index files (genome reference plus transcripts based on Ensembl GRCh38 version)

  Users have to download the index files in ~/reference following the settings:
    cd ~/reference
    wget "ftp://ftp.ccb.jhu.edu/pub/infphilo/hisat2/data/grch38_tran.tar.gz"
    tar -vxf grch38_tran.tar.gz
    mv grch38_tran/genome_tran.* .

1.4 Samtools version >= 1.3 (https://github.com/samtools/samtools/releases/download/1.3.1/samtools-1.3.1.tar.bz2)

  If samtools is not available in the system, users have to download and install it locally. 
    PATH=$PATH:/where_is_path_samtools
    export PATH

1.5 R version >= 3.0.3 (https://cran.r-project.org)

1.6 Genomic data and annotations

    cd ~/reference
    #-- whole genome sequences (build GRCh38 version)
    wget "https://zenodo.org/record/4036439/files/GRCh38.primary_assembly.genome.fa?download=1" && mv "GRCh38.primary_assembly.genome.fa?download=1" GRCh38.primary_assembly.genome.fa
    #-- gene annotation file
    wget "https://zenodo.org/record/4036439/files/Gene_hg38.txt?download=1" && mv "Gene_hg38.txt?download=1" Gene_hg38.txt 
    #-- the human transcriptome sequences annotated from ensembl database (Ensembl Archive Release 89)
    wget "https://zenodo.org/record/4036439/files/ensembl_transcript.fa?download=1" && mv "ensembl_transcript.fa?download=1" ensembl_transcript.fa 
    #-- the human transcriptome sequences annotated from GENCODE database (Release version 27)
    wget "https://zenodo.org/record/4036439/files/gencode_transcript.fa?download=1" && mv "gencode_transcript.fa?download=1" gencode_transcript.fa
    #-- the human transcriptome sequences annotated from UCSC database (Release date: May 2019)
    wget "https://zenodo.org/record/4036439/files/ucsc_transcript.fa?download=1" && mv "ucsc_transcript.fa?download=1" ucsc_transcript.fa 
    wget "https://zenodo.org/record/4036439/files/ucsc_refGene.txt?download=1" && mv "ucsc_refGene.txt?download=1" ucsc_refGene.txt

1.7 Set Perl libraries to environment variables

  PERL5LIB="$PERL5LIB:/where_is_path/ScaR/lib"
  export PERL5LIB
  NOTE: we recommend that users add the path of perl libraries to .bashrc, then "source .bashrc"

2. Optional dependencies

If users would like to use an optional aligner STAR instead of the default HiSAT2:

2.1 STAR v2.7.2d (https://github.com/alexdobin/STAR/archive/2.7.2d.tar.gz)

  The binary executable files have been integrated in ~/bin/STAR-2.7.2d/, please add a working path to Linux environment variables before running:
    PATH=$PATH:/where_is_path/ScaR/bin/STAR-2.7.2d/
    export PATH

2.2 STAR aligner SA index files (genome reference plus transcript annotation in gtf format)

  Users can download index files that were pre-build on basis of GRCh38 genome reference and Ensembl v89 transcript annotations)
    cd ~/reference
    wget "http://folk.uio.no/senz/STAR_index.tar.gz"
    tar -vxf STAR_index.tar.gz
    mv STAR_index/* .
    
    NOTE: Users can generate their own genome indexes with most latest assemblies and annotations.

3. Usage of the "select_read.pl"

3.1 See running parameters

  perl select_read.pl --help

3.2 An example of running:

  perl select_read.pl
  
  --first ~/examples/input/raw_1.fastq 
  # Raw *.fastq or compressed *.fastq.gz file for the 1st end of paired-end reads
  
  --second ~/examples/input/raw_2.fastq 
  # Raw *.fastq or compressed *.fastq.gz file for the 2nd end of paired-end reads
  
  --geneA RCC1 --geneB ABHD12B 
  # Fusion partner gene names (Refseq gene symbol and Ensembl id are accepted)
  
  --anchor 6 
  # (default: 6)
  # Set the length of anchor. The minimum number of bases is required to match to geneA/geneB region in the scaffold sequence.
  
  --trimm 0 
  # (default: 0)
  # Set whether the input fastq reads are trimmed (1) or not (0)
  
  --length 48 
  # Set the maximum length of reads, this option is only available when raw fastq reads are trimmed (--trimm 1)
  
  --transAlign
  # (default: hisat2)
  # Set an aligner to map reads at transcriptome level using no-splicing mode (Options: hisat2 or star)
  
  --genomeAlign
  # (default: hisat2)
  # Set an aligner to map reads at genome level using splicing mode (Options: hisat2 or star)
  
  --trans_ref ensembl
  # (default: ensembl)
  # Set the resource of transcript sequence data (Options: gencode, ensembl or ucsc).
  
  --p 8 
  # (default: 8)
  # The number of threads for running in parallel. 
  
  --anno ~/reference/ 
  # Set the directory path of genomic, transcriptomic sequences and annotations
  
  --output ~/examples/output/ 
  # Output directory
  
  --scaffold ~/examples/input/RCC1_ABHD12B_scaff_seq.fa 
  # A list of fusion scaffold sequences in fasta format (if --scaffold is active, --coordinate has to be inactivated)
  # For instance:
  #	>alt_0
  #	XXXXXXXXXXXXXXXXXX|YYYYYYYYYYYYYYYY
  #	>alt_1
  #	XXXXXXXXXXXXXXXXXX*YYYYYYYYYYYYYYY
  # NOTE: 1. '*' or '|' is accepted as a separator for breakpoint sequences.
  #       2. To ensure the specificity of breakpoint sequences matching to the reference, we recommend that the lengths of 'XXXXXXXX' and 'YYYYYYYY' have to be at least 20 bp.
  #       3. In general, the breakpoint sequences are composed of cDNAs (i.e. exon region). If users would like to detect the fusion sequences including intron/intergenic region, they have to set user-defined reference sequences, please see the usage of parameter "--user_ref".

  --coordinate "chr1:34114119|chr2:65341523,chr1:3412125|chr2:65339145" or "chr1:34114119:+|chr2:65341523:-,chr1:3412125|chr2:65339145"
  # Set genomic junction coordinates (build GRCh38) of breakpoint sites and strand directions (optional input) for GeneA and GeneB, e.g. chr1:34114119:+ and chr2:65341523:- correpsond to the chromosome names, genomic breakpoints and strand directions (optional) of GeneA and GeneB, respectively. (if --coordinate is active, --scaffold has to be inactivated)
  
  --user_ref ~/upstream.fasta
  # User-defined reference sequences, users can specify transcript reference sequences (or genomic sequences) in fasta format which are not present in the provided annotation databases.
  # For instance:
  # >RP11-599B13.3|alternative1
  # CTTTGTGTCTTTGTCTTTATTTCTTTTCTCATTCCCTCGTCTCCACCGGGAAGGGGAGAGCCTGCGGGTGGTGTATCAGGCAGGTTCCCCTACATCTTTGGCACCCAACAC
  # NOTE: 'RP11-599B13.3' is the gene name and has to be identical to the input of gene partner names; 'alternative1' is the transcript name (please avoid using the symbol '_ $ % & # * @ ^ ? + ! < > | / \' in user-defined transcript name). Make sure both 'RP11-599B13.3' and 'alternative1' are together, and separated by '|'.

4. Output results

For example: ~/examples/output/

  • scaffold_*_seq.fa (cDNA sequences of geneA and geneB, and breakpoint sequence of scaffold in fasta format)
  • discordant_split_1.txt, discordant_split_2.txt (paired-end reads in fastq format: one-end maps to scaffold; the other maps to geneA/geneB)
  • singlton_split_1.txt, singlton_split_2.txt (paired-end reads in fastq format: one-end maps to scaffold; the other has no mapping to geneA/geneB)
  • spanning_1.txt, spanning_2.txt (paired-end reads in fastq format: one-end maps to geneA; the other maps to geneB)
  • read_mapped_info (mapping summary of discordant/singlton split reads and spanning reads)
  • *final_read_mapped_info (mapping summary of discordant/singlton split and spanning reads after filtering out unspecific mapping)
  • *final_split_1.txt, final_split_2.txt (merge discordant and singlton split reads in fastq format after filtering out unspecific mapping)
  • *final_spanning_1.txt, final_spanning_1.txt (spanning reads in fastq format after filtering out unspecific mapping)
  • *final_spanning_noclip.sorted.bam (filtered spanning reads mapped to GeneA/GeneB/scaffold sequence). If there are no spanning reads, "final_spanning_noclip.sorted.bam" is absent.
  • *final_split_noclip.sorted.bam (filtered discordant/singlton split reads mapped to GeneA/GeneB/scaffold sequence). If there are no discordant/singlton split reads, "final_split_noclip.sorted.bam" is absent.
  • *summary_read_mapping_support.txt (the number and fraction of discordant split and spanning reads that show a unique alignment to GeneA, GeneB and scaffold, after filtering out unspecific mapped reads)

*: files with bold name are important for users

5. Summarize the number of spanning and split reads across a cohort of samples (run evaluate.pl)

5.1 See running parameters: perl evaluate.pl --help

5.2 An example of running: Users have to make a directory that contains outputs from select_read.pl for summarizing. For instance in "examples" directory, if RCC1_ABHD12B_new folder is not present, mkdir RCC1_ABHD12B_new && cp -r output RCC1_ABHD12B_new/, then run evaluate.pl as follows:

  perl evaluate.pl 
  
  --input ~/examples/RCC1_ABHD12B_new 
  # Set the input path
  
  --output ~/examples/RCC1_ABHD12B_summary 
  # Set the output directory of running "evaluate.pl"

5.3 Summarize output directory of evaluate.pl

 For example: ~/examples/RCC1_ABHD12B_summary

    * summary.txt (the number of read support [discordant_split, singlton_split; spanning] for breakpoint scaffold sequence across a cohort of samples; statistics test for mapping distribution bias to scaffold sequence)

    * alt_0 (concatenate all split reads across a cohort of samples, and align to scaffold sequence)

    |--- "All_sample_split_1.txt, All_sample_split_2.txt" (paired-end discordant/singlton split reads concatenated across all samples)
    |--- "All_sample_noclip.sorted.bam" (align concatenated split reads to scaffold sequence, and user can visualize this bam file uisng scaffold_ENST00000373833_49_ENST00000337334_48_seq.fa as reference by IGV)
    |--- "p.value" (fisher exact test and chi-squred test for mapping distribution bias to upstream/downstream of scaffold sequence)

6. Installation/Running via Docker

6.1 Install the Docker engine in your OS platform

6.2 Allocate computational resource to docker, e.g.

  • Memory: min 4GB for ScaR running
  • CPUs: 4 (Users have to set up based on their own hardwares)
  • Swap: 1GB (ScaR does not need a large memory for running, so keep a small mount of Swap space)

6.3 Pull / Build ScaR engine image

6.3.1 Requirements

  • For Linux and Mac users, root privilege is needed. If you are non-root user, please refer to this setting.

6.3.2 Pull image from Docker Hub/Cloud repositories

  • Users can pull the ScaR engine image directly from Docker Hub (approx 9Gb) which has been built and pushed to Docker Hub/Cloud repositories in advance. Run docker pull senzhao/scar:latest. After that, check the image by typing docker images

6.3.3 Build image from docker container (optional)

  • If users would like to build the ScaR engine image instead of pulling it from Docker Hub, just download the soruce code and change to directory cd ~/ScaR-master, and then run docker build --rm -t senzhao/scar:latest -f Dockerfile_ubunta .. NOTE: building may take a long process (around 30 mins) and also needs a disk image size with at least 50G.
  • After building is done, check the images by typing docker images

6.4 Run ScaR engine image

6.4.1 Usage - display all parameters: docker run -t --rm senzhao/scar perl /ScaR/select_read.pl

6.4.2 Run an example using the data in the "examples" directory:

docker run -t --rm -v /input_data_path/examples:/data senzhao/scar perl /ScaR/select_read.pl --p 4 \
            --first input/raw_1.fastq \
            --second input/raw_2.fastq \
            --geneA RCC1 --geneB ABHD12B --trimm 0 \
            --scaffold input/RCC1_ABHD12B_scaff_seq.fa \
            --anno /reference \
            --output output
            
docker run -t --rm -v /input_data_path/examples:/data senzhao/scar perl /ScaR/select_read.pl --p 4 \
            --first input/raw_1.fastq \
            --second input/raw_2.fastq \
            --geneA RCC1 --geneB ABHD12B --trimm 0 \
            --coordinate "chr1:28508159|chr14:50901829" \
            --anno /reference \
            --output output

Some notes for running ScaR using STAR aligner under Docker framework:

  • As STAR genome index files are very large, we do not pack them into container and create a huge image (it can be harder to distribute and use). The best way to load the STAR genome index files in host machine is to use a "bind mount" solution to attach the volume to the container. For example, if the storage directory in host machine is /input_data_path/examples,

    cd /input_data_path/examples
    wget "http://folk.uio.no/senz/STAR_index.tar.gz"
    tar -vxf STAR_index.tar.gz
    
  • If user would like to use the index files generated by theirselves, please make a new folder named STAR_index (always keep this name) and transfer all index files (e.g. SA, SAindex, Genome) within /input_data_path/examples/STAR_index.

  docker run -t --rm -v /input_data_path/examples:/data senzhao/scar perl /ScaR/select_read.pl --p 4 \
              --first input/raw_1.fastq \
              --second input/raw_2.fastq \
              --geneA RCC1 --geneB ABHD12B --trimm 0 \
              --transAlign star \
              --genomeAlign star \
              --scaffold input/RCC1_ABHD12B_scaff_seq.fa \
              --anno /reference \
              --output output
  • "perl /ScaR/select_read.pl" - the running path of ScaR in docker image (NOTE: keep it as "/ScaR/select_read.pl").
  • "/input_data_path/examples" - set the full path of input directory (it contains both raw reads and scaffold sequence files) in host machine.
  • "input/raw_1.fastq" - set the path of R1-end read file (relative path to input directory /input_data_path/examples in host machine).
  • "input/raw_2.fastq" - set the path of R2-end read file (relative path to input directory /input_data_path/examples in host machine).
  • "input/RCC1_ABHD12B_scaff_seq.fa" - set the path of scaffold sequence file (relative path to input directory /input_data_path/examples in host machine).
  • "/reference" - the path of reference and annotation files in docker image (NOTE: keep it as "/reference")
  • "output" - set the output of ScaR running (relative path to the directory /input_data_path/examples in host machine).

6.4.3 Run an example of evaluate.pl for summarizing the number of spanning and split reads across a cohort of samples: Users have to make a directory that contains outputs from select_read.pl for summarizing. For instance in "examples" directory, if RCC1_ABHD12B_new folder is not present, mkdir RCC1_ABHD12B_new && cp -r output RCC1_ABHD12B_new/, then run evaluate.pl as follows.

docker run -t --rm -v /input_data_path/examples:/data senzhao/scar perl /ScaR/evaluate.pl \
    --input RCC1_ABHD12B_new --output RCC1_ABHD12B_summary

7. Reference

  1. Kim D, Langmead B, and Salzberg SL, HISAT: a fast spliced aligner with low memory requirements. Nature Methods 12, 357-360 (2015). DIO:10.1038/nmeth.3317
  2. Li H., Handsaker B., Wysoker A., Fennell T., Ruan J., Homer N., Marth G., Abecasis G., Durbin R. and 1000 Genome Project Data Processing Subgroup. The Sequence alignment/map (SAM) format and SAMtools. Bioinformatics, 25, 2078-9 (2009). DOI: 10.1093/bioinformatics/btp352
  3. Dobin A, Davis CA, Schlesinger F, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29(1):15–21. doi:10.1093/bioinformatics/bts635
  4. Zhao S*., Andreas M Hoff*, Rolf I Skotheim, ScaR—a tool for sensitive detection of known fusion transcripts: establishing prevalence of fusions in testicular germ cell tumors. NAR Genomics and Bioinformatics, Volume 2, Issue 1, March 2020, lqz025, https://doi.org/10.1093/nargab/lqz025 (* equal contribution)

Contact

t.cytotoxic@gmail.com

About

Use scaffold realigning strategy to detect the recurrence of a list fusion transcripts across samples

Topics

Resources

Stars

3 stars

Watchers

0 watching

Forks

Packages

 
 
 

Contributors